HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13901703: CC10.14E1a_HostT

Sample data for SAMEA13901703, a HoloFood transcriptomic chicken sample


Sample details
Animal
Chicken SAMEA112904881
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA13901703 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13901703, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13901703 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:35Z None
INSDC last update 2023-03-22T12:22:35Z None
INSDC status public None
SRA accession ERS11502152 None
Submitter Id CC10_14E1a_RAW_HostT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-10-14 None
common name chicken None
description Chicken host transcriptome data from Caecum mucosa; animal CC10.14 from cage CC10 with treatment CE; Raw data None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum mucosa None
host breed Ross None
host common name Chicken None
host diet treatment Prebiotic None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CC10.14 None
host taxid 9031 None
host total mass 1678 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection cDNA None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Transcriptome None
reference host genome for decontamination GCF_000000000.0 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method Illumina NovaSeq 6000 None
title CC10.14E1a_HostT None
trial length 35 day
trial timepoint 35 day

Sample metadata

Marker Measurement Units
Body site caecum mucosa None
Experiment transcriptomics None
Organism Chicken None
Project HoloFood None
Sample code CC10.14E1a None

Treatment metadata

Marker Measurement Units
Treatment code CE None
Treatment name Prebiotic None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Nucleotide sequencing data

Sample SAMEA13901703 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,841,465,900bp sequenced by 38,943,106 reads. View sample SAMEA13901703 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13901703 CC10.14E1a_HostT
Reads (Run) ERR9517068 webin-reads-CC10_14E1a_RAW_HostT
Reads (Experiment) ERX9058607 Illumina NovaSeq 6000 sequencing: Raw reads: CC10_14E1a_RAW_HostT
Project/Study PRJEB52095 HoloFood Chicken Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13901703