Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13901646, a HoloFood transcriptomic chicken sample
Metadata for sample SAMEA13901646, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA13901646 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:22:35Z | None |
INSDC last update | 2023-03-22T12:22:35Z | None |
INSDC status | public | None |
SRA accession | ERS11502096 | None |
Submitter Id | CC02_09B1a_RAW_HostT | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2019-09-30 | None |
common name | chicken | None |
description | Chicken host transcriptome data from Ileum mucosa; animal CC02.09 from cage CC02 with treatment CO; Raw data | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Ileum mucosa | None |
host breed | Cobb | None |
host common name | Chicken | None |
host diet treatment | Probiotic | None |
host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CC02.09 | None |
host taxid | 9031 | None |
host total mass | 948 | g |
library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
library selection | cDNA | None |
nucleic acid extraction | D-rex protocol | None |
organism | Gallus gallus | None |
project | HoloFood | None |
project name | HoloFood Chicken - Host Transcriptome | None |
reference host genome for decontamination | GCF_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Gallus gallus | None |
sequencing method | Illumina NovaSeq 6000 | None |
title | CC02.09B1a_HostT | None |
trial length | 35 | day |
trial timepoint | 21 | day |
Marker | Measurement | Units |
---|---|---|
Body site | ileum mucosa | None |
Experiment | transcriptomics | None |
Organism | Chicken | None |
Project | HoloFood | None |
Sample code | CC02.09B1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CO | None |
Treatment name | Probiotic | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CC | None |
Trial description | Trial 3 | None |
Trial end | 2019-07-14 | None |
Trial start | 2019-06-09 | None |
Sample SAMEA13901646 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 2,408,324,400bp sequenced by 16,055,496 reads. View sample SAMEA13901646 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA13901646 | CC02.09B1a_HostT |
Reads (Run) | ERR9516397 | webin-reads-CC02_09B1a_RAW_HostT |
Reads (Experiment) | ERX9057936 | Illumina NovaSeq 6000 sequencing: Raw reads: CC02_09B1a_RAW_HostT |
Project/Study | PRJEB52095 | HoloFood Chicken Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13901646