Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13901601, a HoloFood transcriptomic chicken sample
Metadata for sample SAMEA13901601, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units | 
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None | 
| ENA-FIRST-PUBLIC | 2023-03-22 | None | 
| ENA-LAST-UPDATE | 2023-03-22 | None | 
| External Id | SAMEA13901601 | None | 
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None | 
| INSDC center name | UNIVERSITY OF COPENHAGEN | None | 
| INSDC first public | 2023-03-22T12:22:35Z | None | 
| INSDC last update | 2023-03-22T12:22:35Z | None | 
| INSDC status | public | None | 
| SRA accession | ERS11502051 | None | 
| Submitter Id | CB15_04B1a_RAW_HostT | None | 
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None | 
| collection date | 2019-05-07 | None | 
| common name | chicken | None | 
| description | Chicken host transcriptome data from Ileum mucosa; animal CB15.04 from cage CB15 with treatment CO; Raw data | None | 
| geographic location (country and/or sea) | Spain | None | 
| geographic location (latitude) | 41.17 | DD | 
| geographic location (longitude) | 1.1685 | DD | 
| geographic location (region and locality) | El Morell; Tarragona | None | 
| host body site | Ileum mucosa | None | 
| host breed | Ross | None | 
| host common name | Chicken | None | 
| host diet treatment | Probiotic | None | 
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None | 
| host scientific name | Gallus gallus | None | 
| host sex | female | None | 
| host storage container temperature | 21 | °C | 
| host subject id | CB15.04 | None | 
| host taxid | 9031 | None | 
| host total mass | 199.2 | g | 
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None | 
| library selection | cDNA | None | 
| nucleic acid extraction | D-rex protocol | None | 
| organism | Gallus gallus | None | 
| project | HoloFood | None | 
| project name | HoloFood Chicken - Host Transcriptome | None | 
| reference host genome for decontamination | GCF_000000000.0 | None | 
| sample storage buffer | Shield | None | 
| sample storage container | E-matrix 2ml | None | 
| sample storage location | UCPH | None | 
| sample storage temperature | -20 | °C | 
| sample volume or weight for DNA extraction | 0.2 | mL | 
| scientific_name | Gallus gallus | None | 
| sequencing method | Illumina NovaSeq 6000 | None | 
| title | CB15.04B1a_HostT | None | 
| trial length | 35 | day | 
| trial timepoint | 7 | day | 
| Marker | Measurement | Units | 
|---|---|---|
| Body site | ileum mucosa | None | 
| Experiment | transcriptomics | None | 
| Organism | Chicken | None | 
| Project | HoloFood | None | 
| Sample code | CB15.04B1a | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Treatment code | CO | None | 
| Treatment name | Probiotic | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Trial code | CB | None | 
| Trial description | Trial 2 | None | 
| Trial end | 2019-05-19 | None | 
| Trial start | 2019-04-21 | None | 
Sample SAMEA13901601 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,472,186,900bp sequenced by 36,481,246 reads. View sample SAMEA13901601 in ENA
| Data domain | Accession | Title/alias | 
|---|---|---|
| Sample | SAMEA13901601 | CB15.04B1a_HostT | 
| Reads (Run) | ERR9516974 | webin-reads-CB15_04B1a_RAW_HostT | 
| Reads (Experiment) | ERX9058513 | Illumina NovaSeq 6000 sequencing: Raw reads: CB15_04B1a_RAW_HostT | 
| Project/Study | PRJEB52095 | HoloFood Chicken Host Transcriptome | 
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13901601