HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13604656: SC15.15C1a

Sample data for SAMEA13604656, a HoloFood metagenomic-assembly salmon sample


Sample details
Animal
Salmon SAMEA112949157
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA13604656 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13604656, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13604656 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:31Z None
INSDC last update 2023-03-22T12:22:31Z None
INSDC status public None
SRA accession ERS11206832 None
Submitter Id SC15_15C1a_metaG None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2021-06-30 None
common name fish gut metagenome None
description Salmon metagenomic data from Distal gut content; animal SC15.15 from tank SC15 with treatment And None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Ensilaged blue mussel protein None
host diet treatment And: SC Ensilaged blue mussel 0.0% None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 69 g
host length 18 cm
host scientific name Salmo salar None
host storage container LetSea Tank: And None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SC15.15 None
host taxid 8030 None
host total mass 78 g
library name Plant and Animal Whole Genome library (350bp) None
library selection size fractionation None
nucleic acid extraction D-rex protocol None
organism fish gut metagenome None
project HoloFood None
project name HoloFood Salmon - Trial C Metagenome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name fish gut metagenome None
sequencing method Illumina Novaseq 6000 None
title SC15.15C1a None
trial timepoint 77 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment metagenomics None
Organism Salmon None
Project HoloFood None
Sample code SC15.15C1a None

Treatment metadata

Marker Measurement Units
Treatment code And None
Treatment concentration 0.0% %
Treatment description Ensilaged blue mussel protein None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SC None
Trial description Trial C: Blue mussel ensilage-dose response None
Trial end 2021-05-27 None
Trial start 2021-03-09 None
Metagenomics

Sample SAMEA13604656 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA13604656 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 7,524,105bp sequenced by 50,792 reads. View sample SAMEA13604656 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13604656 SC15.15C1a
Reads (Run) ERR9358556 webin-reads-SC15_15C1a_metaG
Reads (Experiment) ERX8900458 Illumina NovaSeq 6000 sequencing: Raw reads: SC15_15C1a_metaG
Project/Study PRJEB51815 HoloFood Salmon Trial C Gut Metagenome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13604656