Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13604648, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA13604648, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA13604648 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:22:31Z | None |
INSDC last update | 2023-03-22T12:22:31Z | None |
INSDC status | public | None |
SRA accession | ERS11206824 | None |
Submitter Id | SC15_01C1a_metaG | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2021-03-10 | None |
common name | fish gut metagenome | None |
description | Salmon metagenomic data from Distal gut content; animal SC15.01 from tank SC15 with treatment And | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Ensilaged blue mussel protein | None |
host diet treatment | And: SC Ensilaged blue mussel 0.0% | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 16.4 | g |
host length | 11.2 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: And | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SC15.01 | None |
host taxid | 8030 | None |
host total mass | 19.6 | g |
library name | Plant and Animal Whole Genome library (350bp) | None |
library selection | size fractionation | None |
nucleic acid extraction | D-rex protocol | None |
organism | fish gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Salmon - Trial C Metagenome | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | fish gut metagenome | None |
sequencing method | Illumina Novaseq 6000 | None |
title | SC15.01C1a | None |
trial timepoint | 0 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | metagenomics | None |
Organism | Salmon | None |
Project | HoloFood | None |
Sample code | SC15.01C1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | And | None |
Treatment concentration | 0.0% | % |
Treatment description | Ensilaged blue mussel protein | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SC | None |
Trial description | Trial C: Blue mussel ensilage-dose response | None |
Trial end | 2021-05-27 | None |
Trial start | 2021-03-09 | None |
Sample SAMEA13604648 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA13604648 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 8,552,509bp sequenced by 57,768 reads. View sample SAMEA13604648 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA13604648 | SC15.01C1a |
Reads (Run) | ERR9360636 | webin-reads-SC15_01C1a_metaG |
Reads (Experiment) | ERX8902570 | Illumina NovaSeq 6000 sequencing: Raw reads: SC15_01C1a_metaG |
Project/Study | PRJEB51815 | HoloFood Salmon Trial C Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13604648