Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13604589, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA13604589, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13604589 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:32Z | None |
| INSDC last update | 2023-03-22T12:22:32Z | None |
| INSDC status | public | None |
| SRA accession | ERS11206765 | None |
| Submitter Id | SC10_01C1a_metaG | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2021-03-10 | None |
| common name | fish gut metagenome | None |
| description | Salmon metagenomic data from Distal gut content; animal SC10.01 from tank SC10 with treatment And | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Ensilaged blue mussel protein | None |
| host diet treatment | And: SC Ensilaged blue mussel 0.0% | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 12.2 | g |
| host length | 10.5 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: And | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SC10.01 | None |
| host taxid | 8030 | None |
| host total mass | 14.8 | g |
| library name | Plant and Animal Whole Genome library (350bp) | None |
| library selection | size fractionation | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - Trial C Metagenome | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | fish gut metagenome | None |
| sequencing method | Illumina Novaseq 6000 | None |
| title | SC10.01C1a | None |
| trial timepoint | 0 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metagenomics | None |
| Organism | Salmon | None |
| Project | HoloFood | None |
| Sample code | SC10.01C1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | And | None |
| Treatment concentration | 0.0% | % |
| Treatment description | Ensilaged blue mussel protein | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SC | None |
| Trial description | Trial C: Blue mussel ensilage-dose response | None |
| Trial end | 2021-05-27 | None |
| Trial start | 2021-03-09 | None |
Sample SAMEA13604589 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA13604589 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 23,543,831bp sequenced by 158,088 reads. View sample SAMEA13604589 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13604589 | SC10.01C1a |
| Reads (Run) | ERR9360676 | webin-reads-SC10_01C1a_metaG |
| Reads (Experiment) | ERX8902610 | Illumina NovaSeq 6000 sequencing: Raw reads: SC10_01C1a_metaG |
| Project/Study | PRJEB51815 | HoloFood Salmon Trial C Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13604589