Could not connect to MGnify right now. Please try later.
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13604567, a HoloFood metagenomic-assembly salmon sample
Metadata for sample SAMEA13604567, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13604567 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:31Z | None |
| INSDC last update | 2023-03-22T12:22:31Z | None |
| INSDC status | public | None |
| SRA accession | ERS11206743 | None |
| Submitter Id | SC09_03C1a_metaG | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2021-03-10 | None |
| common name | fish gut metagenome | None |
| description | Salmon metagenomic data from Distal gut content; animal SC09.03 from tank SC09 with treatment Spurv | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Ensilaged blue mussel protein | None |
| host diet treatment | Spurv: SC Ensilaged blue mussel 10.0% | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 17.8 | g |
| host length | 11.7 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Spurv | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SC09.03 | None |
| host taxid | 8030 | None |
| host total mass | 21.2 | g |
| library name | Plant and Animal Whole Genome library (350bp) | None |
| library selection | size fractionation | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | fish gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - Trial C Metagenome | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | fish gut metagenome | None |
| sequencing method | Illumina Novaseq 6000 | None |
| title | SC09.03C1a | None |
| trial timepoint | 0 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | metagenomics | None |
| Organism | Salmon | None |
| Project | HoloFood | None |
| Sample code | SC09.03C1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Spurv | None |
| Treatment concentration | 10.0% | % |
| Treatment description | Ensilaged blue mussel protein | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SC | None |
| Trial description | Trial C: Blue mussel ensilage-dose response | None |
| Trial end | 2021-05-27 | None |
| Trial start | 2021-03-09 | None |
Sample SAMEA13604567 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA13604567 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 21,530,822bp sequenced by 144,370 reads. View sample SAMEA13604567 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13604567 | SC09.03C1a |
| Reads (Run) | ERR9360696 | webin-reads-SC09_03C1a_metaG |
| Reads (Experiment) | ERX8902630 | Illumina NovaSeq 6000 sequencing: Raw reads: SC09_03C1a_metaG |
| Project/Study | PRJEB51815 | HoloFood Salmon Trial C Gut Metagenome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13604567