Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13389764, a HoloFood host-genomic chicken sample
Metadata for sample SAMEA13389764, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA13389764 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:22:29Z | None |
INSDC last update | 2023-03-22T12:22:29Z | None |
INSDC status | public | None |
SRA accession | ERS10992260 | None |
Submitter Id | CC16_14F1a_PCCC_HostG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
collection date | 2019-10-14 | None |
common name | chicken | None |
description | Chicken host genomic data from Caecum content; animal CC16.14 from cage CC16 with treatment CO | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Caecum content | None |
host breed | Ross | None |
host common name | Chicken | None |
host diet treatment | Probiotic | None |
host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CC16.14 | None |
host taxid | 9031 | None |
host total mass | 1514 | g |
library name | BEMT | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Gallus gallus | None |
project | HoloFood | None |
project name | HoloFood Chicken - Host Genome | None |
reference host genome for decontamination | GCF_000002315.6 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Gallus gallus | None |
sequencing method | MGISEQ-2000 | None |
title | CC16.14F1a_HostG | None |
trial length | 35 | day |
trial timepoint | 35 | day |
Marker | Measurement | Units |
---|---|---|
Body site | caecum content | None |
Experiment | genomics | None |
Index PCR cycles | 6 | None |
Lab Process ID | LPC00186 | None |
Organism | Chicken | None |
Pool | PRICH-15BM-521 | None |
Project | HoloFood | None |
Raw sequence name | F20FTSEUHT1189_GALlfqR/PRICH-15BM/PRICH-15BM-521 | None |
Sample code | CC16.14F1a | None |
Sequencing company | BGI | None |
ng used for library build | 316.8 | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CO | None |
Treatment name | Probiotic | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CC | None |
Trial description | Trial 3 | None |
Trial end | 2019-07-14 | None |
Trial start | 2019-06-09 | None |
Sample SAMEA13389764 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 38,515,131bp sequenced by 267,712 reads. View sample SAMEA13389764 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA13389764 | CC16.14F1a_HostG |
Reads (Run) | ERR9353182 | webin-reads-CC16_14F1a_PCCC_HostG |
Reads (Experiment) | ERX8895115 | DNBSEQ-G400 sequencing: Raw reads: CC16_14F1a_PCCC_HostG |
Project/Study | PRJEB45273 | HoloFood Chicken Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389764