HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13389553, a HoloFood host-genomic chicken sample
Metadata for sample SAMEA13389553, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13389553 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:29Z | None |
| INSDC last update | 2023-03-22T12:22:29Z | None |
| INSDC status | public | None |
| SRA accession | ERS10992049 | None |
| Submitter Id | CC01_17F1a_PCCC_HostG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-10-16 | None |
| common name | chicken | None |
| description | Chicken host genomic data from Caecum content; animal CC01.17 from cage CC01 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CC01.17 | None |
| host taxid | 9031 | None |
| host total mass | 2372 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Gallus gallus | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Host Genome | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Gallus gallus | None |
| sequencing method | MGISEQ-2000 | None |
| title | CC01.17F1a_HostG | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | genomics | None |
| Index PCR cycles | 6 | None |
| Lab Process ID | LPC00025 | None |
| Organism | Chicken | None |
| Pool | PRICH-12BM-517 | None |
| Project | HoloFood | None |
| Raw sequence name | F20FTSEUET0072_GALpdyR/PRICH-12BM-517/V300066507_L01_517 | None |
| Sample code | CC01.17F1a | None |
| Sequencing company | BGI | None |
| ng used for library build | 353.7 | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA13389553 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 28,869,693bp sequenced by 200,248 reads. View sample SAMEA13389553 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13389553 | CC01.17F1a_HostG |
| Reads (Run) | ERR9353467 | webin-reads-CC01_17F1a_PCCC_HostG |
| Reads (Experiment) | ERX8895400 | DNBSEQ-G400 sequencing: Raw reads: CC01_17F1a_PCCC_HostG |
| Project/Study | PRJEB45273 | HoloFood Chicken Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389553
