Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13389464, a HoloFood host-genomic chicken sample
Metadata for sample SAMEA13389464, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA13389464 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:22:25Z | None |
INSDC last update | 2023-03-22T12:22:25Z | None |
INSDC status | public | None |
SRA accession | ERS10991960 | None |
Submitter Id | CB17_14C1a_NTMTB_HostG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
collection date | 2019-06-03 | None |
common name | chicken | None |
description | Chicken host genomic data from Ileum content; animal CB17.14 from cage CB17 with treatment CC | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Ileum content | None |
host breed | Cobb | None |
host common name | Chicken | None |
host diet treatment | Control | None |
host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | male | None |
host storage container temperature | 21 | °C |
host subject id | CB17.14 | None |
host taxid | 9031 | None |
host total mass | 2362 | g |
library name | BEMT | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Gallus gallus | None |
project | HoloFood | None |
project name | HoloFood Chicken - Host Genome | None |
reference host genome for decontamination | GCF_000002315.6 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Gallus gallus | None |
sequencing method | MGISEQ-2000 | None |
title | CB17.14C1a_HostG | None |
trial length | 35 | day |
trial timepoint | 35 | day |
Marker | Measurement | Units |
---|---|---|
Body site | ileum content | None |
Experiment | genomics | None |
Organism | Chicken | None |
Project | HoloFood | None |
Sample code | CB17.14C1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CC | None |
Treatment name | Control | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CB | None |
Trial description | Trial 2 | None |
Trial end | 2019-05-19 | None |
Trial start | 2019-04-21 | None |
Sample SAMEA13389464 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 4,365,350,910bp sequenced by 30,012,224 reads. View sample SAMEA13389464 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA13389464 | CB17.14C1a_HostG |
Reads (Run) | ERR9286163 | webin-reads-CB17_14C1a_NTMTB_HostG |
Reads (Experiment) | ERX8828276 | DNBSEQ-G400 sequencing: Raw reads: CB17_14C1a_NTMTB_HostG |
Project/Study | PRJEB45273 | HoloFood Chicken Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389464