HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13389340: CB05.03F1a_HostG

Sample data for SAMEA13389340, a HoloFood host-genomic chicken sample


Sample details
Animal
Chicken SAMEA112904933
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA13389340 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13389340, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13389340 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:25Z None
INSDC last update 2023-03-22T12:22:25Z None
INSDC status public None
SRA accession ERS10991837 None
Submitter Id CB05_03F1a_PCCC_HostG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-05-06 None
common name chicken None
description Chicken host genomic data from Caecum content; animal CB05.03 from cage CB05 with treatment CO None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Probiotic None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CB05.03 None
host taxid 9031 None
host total mass 170 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Genome None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method MGISEQ-2000 None
title CB05.03F1a_HostG None
trial length 35 day
trial timepoint 7 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment genomics None
Index PCR cycles 6 None
Lab Process ID LPC00017 None
Organism Chicken None
Pool PRICH-11BM-509 None
Project HoloFood None
Raw sequence name F20FTSEUET0072_GALpdyR/PRICH-11BM-509/V300066503_L04_509 None
Sample code CB05.03F1a None
Sequencing company BGI None
ng used for library build 387.45 None

Treatment metadata

Marker Measurement Units
Treatment code CO None
Treatment name Probiotic None

Trial metadata

Marker Measurement Units
Trial code CB None
Trial description Trial 2 None
Trial end 2019-05-19 None
Trial start 2019-04-21 None
Nucleotide sequencing data

Sample SAMEA13389340 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 1,259,425,921bp sequenced by 8,687,106 reads. View sample SAMEA13389340 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13389340 CB05.03F1a_HostG
Reads (Run) ERR9353203 webin-reads-CB05_03F1a_PCCC_HostG
Reads (Experiment) ERX8895136 DNBSEQ-G400 sequencing: Raw reads: CB05_03F1a_PCCC_HostG
Project/Study PRJEB45273 HoloFood Chicken Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389340