Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA13389207, a HoloFood host-genomic chicken sample
Metadata for sample SAMEA13389207, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA13389207 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:29Z | None |
| INSDC last update | 2023-03-22T12:22:29Z | None |
| INSDC status | public | None |
| SRA accession | ERS10991704 | None |
| Submitter Id | CA16_18F1a_ECHC_HostG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-03-13 | None |
| common name | chicken | None |
| description | Chicken host genomic data from Caecum content; animal CA16.18 from cage CA16 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Caecum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CA16.18 | None |
| host taxid | 9031 | None |
| host total mass | 2977 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Gallus gallus | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Host Genome | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Gallus gallus | None |
| sequencing method | MGISEQ-2000 | None |
| title | CA16.18F1a_HostG | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | caecum content | None |
| Experiment | genomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CA16.18F1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CA | None |
| Trial description | Trial 1 | None |
| Trial end | 2019-03-11 | None |
| Trial start | 2019-02-04 | None |
Sample SAMEA13389207 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 58,801,940bp sequenced by 404,728 reads. View sample SAMEA13389207 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA13389207 | CA16.18F1a_HostG |
| Reads (Run) | ERR9353212 | webin-reads-CA16_18F1a_ECHC_HostG |
| Reads (Experiment) | ERX8895145 | DNBSEQ-G400 sequencing: Raw reads: CA16_18F1a_ECHC_HostG |
| Project/Study | PRJEB45273 | HoloFood Chicken Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389207