HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA13389136: CA10.12F1a_HostG

Sample data for SAMEA13389136, a HoloFood host-genomic chicken sample


Sample details
Animal
Chicken SAMEA112905292
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA13389136 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA13389136, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA13389136 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:25Z None
INSDC last update 2023-03-22T12:22:25Z None
INSDC status public None
SRA accession ERS10991633 None
Submitter Id CA10_12F1a_MAGCC_HostG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-02-26 None
common name chicken None
description Chicken host genomic data from Caecum content; animal CA10.12 from cage CA10 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Ross None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CA10.12 None
host taxid 9031 None
host total mass 688.8 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Genome None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method MGISEQ-2000 None
title CA10.12F1a_HostG None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment genomics None
Index PCR cycles 12 None
Lab Process ID LPC00270 None
Organism Chicken None
Pool MAG09-518 None
Project HoloFood None
Raw sequence name F19FTSEUET0172_MICrccR/MAG09/200310_I076_V300038549_L2_CDK153B200227010-518/V300038549_L02_518 None
Sample code CA10.12F1a None
Sequencing company BGI None
ng used for library build 385 None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CA None
Trial description Trial 1 None
Trial end 2019-03-11 None
Trial start 2019-02-04 None
Nucleotide sequencing data

Sample SAMEA13389136 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 2,184,673,813bp sequenced by 15,086,034 reads. View sample SAMEA13389136 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA13389136 CA10.12F1a_HostG
Reads (Run) ERR9286205 webin-reads-CA10_12F1a_MAGCC_HostG
Reads (Experiment) ERX8828310 DNBSEQ-G400 sequencing: Raw reads: CA10_12F1a_MAGCC_HostG
Project/Study PRJEB45273 HoloFood Chicken Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA13389136