Could not connect to MGnify right now. Please try later.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112750558, a HoloFood metagenomic-amplicon salmon sample
Metadata for sample SAMEA112750558, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-04-21 | None |
ENA-LAST-UPDATE | 2023-04-21 | None |
External Id | SAMEA112750558 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-04-21T12:19:59Z | None |
INSDC last update | 2023-04-21T12:19:59Z | None |
INSDC status | public | None |
SRA accession | ERS14745251 | None |
Submitter Id | SD10_22C1a_16S | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2022-04-04 | None |
common name | Atlantic salmon | None |
description | Salmon 16S amplicon sequencing data from Distal gut content; animal SD10.22 from tank SD10 with treatment SK2 | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Seaweed | None |
host diet treatment | SK2 SD Fermented seaweed 2.0% | None |
host diet treatment concentration | 2 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 1855 | g |
host length | 57 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: SK2 | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SD10.22 | None |
host taxid | 8030 | None |
host total mass | 2100 | g |
library name | BEST | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Salmo salar | None |
pcr primers | N/A | None |
project | HoloFood | None |
project name | Holofood Salmon 16S amplicon sequencing | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Salmo salar | None |
sequencing method | Illumina MiSeq | None |
title | SD10.22C1a | None |
trial timepoint | 209 | days |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | amplicon | None |
Organism | Salmon | None |
Project | HoloFood | None |
Sample code | SD10.22C1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | SK2 | None |
Treatment concentration | 2.0% | % |
Treatment description | Seaweed | None |
Marker | Measurement | Units |
---|---|---|
Environment | Open sea pens | None |
Trial code | SD | None |
Trial description | Trial D: Fermented seaweed open water-dose response | None |
Trial end | 2022-05-05 | None |
Trial start | 2021-10-05 | None |
Sample SAMEA112750558 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA112750558 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 809,512bp sequenced by 2,798 reads. View sample SAMEA112750558 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA112750558 | SD10.22C1a |
Reads (Run) | ERR10969003 | webin-reads-SD10_22C1a_16S |
Reads (Experiment) | ERX10405612 | Illumina MiSeq sequencing: Raw reads: SD10_22C1a_16S |
Project/Study | PRJEB59908 | Holofood Salmon 16S amplicon sequencing |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112750558