No analyses found in MGnify
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112750489, a HoloFood metagenomic-amplicon salmon sample
Metadata for sample SAMEA112750489, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-04-21 | None |
| ENA-LAST-UPDATE | 2023-04-21 | None |
| External Id | SAMEA112750489 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-04-21T12:19:59Z | None |
| INSDC last update | 2023-04-21T12:19:59Z | None |
| INSDC status | public | None |
| SRA accession | ERS14745182 | None |
| Submitter Id | SD06_28C1a_16S | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2022-04-04 | None |
| common name | Atlantic salmon | None |
| description | Salmon 16S amplicon sequencing data from Distal gut content; animal SD06.28 from tank SD06 with treatment SK0 | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut content | None |
| host common name | Atlantic salmon | None |
| host diet | Seaweed | None |
| host diet treatment | SK0 SD Fermented seaweed 0.0% | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 1990 | g |
| host length | 56 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: SK0 | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SD06.28 | None |
| host taxid | 8030 | None |
| host total mass | 2305 | g |
| library name | BEST | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Salmo salar | None |
| pcr primers | N/A | None |
| project | HoloFood | None |
| project name | Holofood Salmon 16S amplicon sequencing | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | Shield | None |
| sample storage container | 2ml E-matrix | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Salmo salar | None |
| sequencing method | Illumina MiSeq | None |
| title | SD06.28C1a | None |
| trial timepoint | 209 | days |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut content | None |
| Experiment | amplicon | None |
| Organism | Salmon | None |
| Project | HoloFood | None |
| Sample code | SD06.28C1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | SK0 | None |
| Treatment concentration | 0.0% | % |
| Treatment description | Seaweed | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Open sea pens | None |
| Trial code | SD | None |
| Trial description | Trial D: Fermented seaweed open water-dose response | None |
| Trial end | 2022-05-05 | None |
| Trial start | 2021-10-05 | None |
Sample SAMEA112750489 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA112750489 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 80,761,181bp sequenced by 279,036 reads. View sample SAMEA112750489 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA112750489 | SD06.28C1a |
| Reads (Run) | ERR10969028 | webin-reads-SD06_28C1a_16S |
| Reads (Experiment) | ERX10405637 | Illumina MiSeq sequencing: Raw reads: SD06_28C1a_16S |
| Project/Study | PRJEB59908 | Holofood Salmon 16S amplicon sequencing |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112750489