HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112750434: SD03.28C1a

Sample data for SAMEA112750434, a HoloFood metagenomic-amplicon salmon sample


Sample details
Animal
Salmon SAMEA112949081
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-amplicon
API endpoint
/api/samples/SAMEA112750434 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112750434, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-04-21 None
ENA-LAST-UPDATE 2023-04-21 None
External Id SAMEA112750434 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-04-21T12:19:59Z None
INSDC last update 2023-04-21T12:19:59Z None
INSDC status public None
SRA accession ERS14745127 None
Submitter Id SD03_28C1a_16S None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2022-04-04 None
common name Atlantic salmon None
description Salmon 16S amplicon sequencing data from Distal gut content; animal SD03.28 from tank SD03 with treatment SK1 None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Seaweed None
host diet treatment SK1 SD Fermented seaweed 1.0% None
host diet treatment concentration 1 % mass
host disease status Wounded:- None
host gutted mass 2020 g
host length 57.5 cm
host scientific name Salmo salar None
host storage container LetSea Tank: SK1 None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SD03.28 None
host taxid 8030 None
host total mass 2310 g
library name BEST None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
pcr primers N/A None
project HoloFood None
project name Holofood Salmon 16S amplicon sequencing None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method Illumina MiSeq None
title SD03.28C1a None
trial timepoint 209 days

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment amplicon None
Organism Salmon None
Project HoloFood None
Sample code SD03.28C1a None

Treatment metadata

Marker Measurement Units
Treatment code SK1 None
Treatment concentration 1.0% %
Treatment description Seaweed None

Trial metadata

Marker Measurement Units
Environment Open sea pens None
Trial code SD None
Trial description Trial D: Fermented seaweed open water-dose response None
Trial end 2022-05-05 None
Trial start 2021-10-05 None
Metagenomics

Sample SAMEA112750434 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA112750434 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 28,653,614bp sequenced by 99,320 reads. View sample SAMEA112750434 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112750434 SD03.28C1a
Reads (Run) ERR10968949 webin-reads-SD03_28C1a_16S
Reads (Experiment) ERX10405558 Illumina MiSeq sequencing: Raw reads: SD03_28C1a_16S
Project/Study PRJEB59908 Holofood Salmon 16S amplicon sequencing

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112750434