HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112642765: SA10.15C1a

Sample data for SAMEA112642765, a HoloFood metagenomic-amplicon salmon sample


Sample details
Animal
Salmon SAMEA112949034
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-amplicon
API endpoint
/api/samples/SAMEA112642765 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112642765, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-04-21 None
ENA-LAST-UPDATE 2023-04-21 None
External Id SAMEA112642765 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-04-21T12:19:58Z None
INSDC last update 2023-04-21T12:19:58Z None
INSDC status public None
SRA accession ERS14634734 None
Submitter Id SA10_15C1a_16S None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-08-12 None
common name Atlantic salmon None
description Salmon 16S amplicon sequencing data from Distal gut content; animal SA10.15 from tank SA10 with treatment Jaguar None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Jaguar SA Seaweed 2% None
host diet treatment concentration 2 % mass
host disease status Wounded:- None
host gutted mass 533.6 g
host length 36 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Jaguar None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA10.15 None
host taxid 8030 None
host total mass 629 g
library name BEST None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
pcr primers N/A None
project HoloFood None
project name Holofood Salmon 16S amplicon sequencing None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method Illumina MiSeq None
title SA10.15C1a None
trial timepoint 60 days

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment amplicon None
Index PCR cycles 9 None
Lab Process ID LPS00720 None
Omics Metagenomics None
Organism Salmon None
Pool S-MG-P20-509 None
Project HoloFood None
Raw seq. name S-MG-P20-509/V300074285_L04_509 None
Sample code SA10.15C1a None
Sequencing company BGI None

Treatment metadata

Marker Measurement Units
Treatment code Jaguar None
Treatment concentration 2.0% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Metagenomics

Sample SAMEA112642765 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA112642765 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 41,363,144bp sequenced by 170,550 reads. View sample SAMEA112642765 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112642765 SA10.15C1a
Reads (Run) ERR10888891 webin-reads-SA10_15C1a_16S
Reads (Experiment) ERX10332905 Illumina MiSeq sequencing: Raw reads: SA10_15C1a_16S
Project/Study PRJEB59908 Holofood Salmon 16S amplicon sequencing

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112642765