HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112445475: SC05.26C1a

Sample data for SAMEA112445475, a HoloFood host-genomic salmon sample


Sample details
Animal
Salmon SAMEA112949486
Sample type
Host genome data icon host-genomic
API endpoint
/api/samples/SAMEA112445475 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112445475, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA112445475 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:24:23Z None
INSDC last update 2023-03-22T12:24:23Z None
INSDC status public None
SRA accession ERS14555760 None
Submitter Id SC05_26C1a_hostG None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2021-06-30 None
common name Atlantic salmon None
description Salmon host genomic data from Distal gut content; animal SC05.26 from tank SC05 with treatment And None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut content None
host common name Atlantic salmon None
host diet Ensilaged blue mussel protein None
host diet treatment And: SC Ensilaged blue mussel 0.0% None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 40 g
host length 15 cm
host scientific name Salmo salar None
host storage container LetSea Tank: And None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SC05.26 None
host taxid 8030 None
host total mass 47 g
library name BEST None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Genome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer Shield None
sample storage container 2ml E-matrix None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method DNBSEQ-G400 None
title SC05.26C1a None
trial timepoint 77 day

Sample metadata

Marker Measurement Units
Body site distal gut content None
Experiment genomics None
Organism Salmon None
Project HoloFood None
Sample code SC05.26C1a None

Treatment metadata

Marker Measurement Units
Treatment code And None
Treatment concentration 0.0% %
Treatment description Ensilaged blue mussel protein None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SC None
Trial description Trial C: Blue mussel ensilage-dose response None
Trial end 2021-05-27 None
Trial start 2021-03-09 None
Nucleotide sequencing data

Sample SAMEA112445475 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 0bp sequenced by 0 reads. View sample SAMEA112445475 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112445475 SC05.26C1a
Reads (Run) ERR10822772 webin-reads-SC05_26C1a_hostG
Reads (Experiment) ERX10268279 DNBSEQ-G400 sequencing: Raw reads: SC05_26C1a_hostG
Project/Study PRJEB45274 HoloFood Salmon Host Genome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112445475