Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112445430, a HoloFood host-genomic salmon sample
Metadata for sample SAMEA112445430, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA112445430 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:24:24Z | None |
INSDC last update | 2023-03-22T12:24:24Z | None |
INSDC status | public | None |
SRA accession | ERS14555715 | None |
Submitter Id | SC03_01C1a_hostG | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2021-03-10 | None |
common name | Atlantic salmon | None |
description | Salmon host genomic data from Distal gut content; animal SC03.01 from tank SC03 with treatment Hegre | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut content | None |
host common name | Atlantic salmon | None |
host diet | Ensilaged blue mussel protein | None |
host diet treatment | Hegre: SC Ensilaged blue mussel 7.5% | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 12.8 | g |
host length | 10.8 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Hegre | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SC03.01 | None |
host taxid | 8030 | None |
host total mass | 15.2 | g |
library name | BEST | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Salmo salar | None |
project | HoloFood | None |
project name | HoloFood Salmon - Host Genome | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | Shield | None |
sample storage container | 2ml E-matrix | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Salmo salar | None |
sequencing method | DNBSEQ-G400 | None |
title | SC03.01C1a | None |
trial timepoint | 0 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut content | None |
Experiment | genomics | None |
Organism | Salmon | None |
Project | HoloFood | None |
Sample code | SC03.01C1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Hegre | None |
Treatment concentration | 7.5% | % |
Treatment description | Ensilaged blue mussel protein | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SC | None |
Trial description | Trial C: Blue mussel ensilage-dose response | None |
Trial end | 2021-05-27 | None |
Trial start | 2021-03-09 | None |
Sample SAMEA112445430 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,731,447,265bp sequenced by 38,718,086 reads. View sample SAMEA112445430 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA112445430 | SC03.01C1a |
Reads (Run) | ERR10824236 | webin-reads-SC03_01C1a_hostG |
Reads (Experiment) | ERX10269273 | DNBSEQ-G400 sequencing: Raw reads: SC03_01C1a_hostG |
Project/Study | PRJEB45274 | HoloFood Salmon Host Genome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112445430