Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112369746, a HoloFood transcriptomic salmon sample
Metadata for sample SAMEA112369746, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA112369746 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:24:19Z | None |
INSDC last update | 2023-03-22T12:24:19Z | None |
INSDC status | public | None |
SRA accession | ERS14480064 | None |
Submitter Id | SB02_20B1a_hostT | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2019-10-14 | None |
common name | Atlantic salmon | None |
description | Salmon host transcriptome data from Distal gut tissue; animal SB02.20 from tank SB02 with treatment Neptune | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut tissue | None |
host common name | Atlantic salmon | None |
host diet | Sanford Blue Mussel Meal | None |
host diet treatment | Neptune SB Blue mussel 13.1% | None |
host diet treatment concentration | 13.1 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 414 | g |
host length | 34.5 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Neptune | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SB02.20 | None |
host taxid | 8030 | None |
host total mass | 485.2 | g |
library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
library selection | rRNA depletion + strand specific library | None |
nucleic acid extraction | D-rex protocol | None |
organism | Salmo salar | None |
project | HoloFood | None |
project name | HoloFood Salmon - Host Transcriptome | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | RNAlater | None |
sample storage container | 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Salmo salar | None |
sequencing method | Illumina Novaseq 6000 | None |
title | SB02.20B1a | None |
trial timepoint | 60 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut tissue | None |
Experiment | transcriptomics | None |
Organism | Salmon | None |
Project | HoloFood | None |
Sample code | SB02.20B1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Neptune | None |
Treatment concentration | 13.1% | % |
Treatment description | Sanford Blue Mussel Meal | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SB | None |
Trial description | Trial B: Blue mussel-dose response | None |
Trial end | 2019-11-22 | None |
Trial start | 2019-08-14 | None |
Sample SAMEA112369746 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 17,063,516,955bp sequenced by 114,081,598 reads. View sample SAMEA112369746 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA112369746 | SB02.20B1a |
Reads (Run) | ERR10808838 | webin-reads-SB02_20B1a_hostT |
Reads (Experiment) | ERX10258423 | Illumina NovaSeq 6000 sequencing: Raw reads: SB02_20B1a_hostT |
Project/Study | PRJEB59276 | HoloFood Salmon Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369746