HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112369741: SB02.15B1a

Sample data for SAMEA112369741, a HoloFood transcriptomic salmon sample


Sample details
Animal
Salmon SAMEA112949256
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA112369741 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112369741, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA112369741 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:24:19Z None
INSDC last update 2023-03-22T12:24:19Z None
INSDC status public None
SRA accession ERS14480059 None
Submitter Id SB02_15B1a_hostT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-10-14 None
common name Atlantic salmon None
description Salmon host transcriptome data from Distal gut tissue; animal SB02.15 from tank SB02 with treatment Neptune None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut tissue None
host common name Atlantic salmon None
host diet Sanford Blue Mussel Meal None
host diet treatment Neptune SB Blue mussel 13.1% None
host diet treatment concentration 13.1 % mass
host disease status Wounded:- None
host gutted mass 405.8 g
host length 34.3 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Neptune None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SB02.15 None
host taxid 8030 None
host total mass 467.8 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Transcriptome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer RNAlater None
sample storage container 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method Illumina Novaseq 6000 None
title SB02.15B1a None
trial timepoint 60 day

Sample metadata

Marker Measurement Units
Body site distal gut tissue None
Experiment transcriptomics None
Organism Salmon None
Project HoloFood None
Sample code SB02.15B1a None

Treatment metadata

Marker Measurement Units
Treatment code Neptune None
Treatment concentration 13.1% %
Treatment description Sanford Blue Mussel Meal None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SB None
Trial description Trial B: Blue mussel-dose response None
Trial end 2019-11-22 None
Trial start 2019-08-14 None
Nucleotide sequencing data

Sample SAMEA112369741 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 15,107,157,027bp sequenced by 100,929,238 reads. View sample SAMEA112369741 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112369741 SB02.15B1a
Reads (Run) ERR10808166 webin-reads-SB02_15B1a_hostT
Reads (Experiment) ERX10257751 Illumina NovaSeq 6000 sequencing: Raw reads: SB02_15B1a_hostT
Project/Study PRJEB59276 HoloFood Salmon Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369741