HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112369711: SB01.05B1a

Sample data for SAMEA112369711, a HoloFood transcriptomic salmon sample


Sample details
Animal
Salmon SAMEA112949639
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA112369711 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112369711, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA112369711 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:24:21Z None
INSDC last update 2023-03-22T12:24:21Z None
INSDC status public None
SRA accession ERS14480029 None
Submitter Id SB01_05B1a_hostT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-08-14 None
common name Atlantic salmon None
description Salmon host transcriptome data from Distal gut tissue; animal SB01.05 from tank SB01 with treatment Mars None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut tissue None
host common name Atlantic salmon None
host diet Sanford Blue Mussel Meal None
host diet treatment Mars SB Blue mussel 0% None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 161.2 g
host length 27 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Mars None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SB01.05 None
host taxid 8030 None
host total mass 192.8 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Transcriptome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer RNAlater None
sample storage container 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method Illumina Novaseq 6000 None
title SB01.05B1a None
trial timepoint 0 day

Sample metadata

Marker Measurement Units
Body site distal gut tissue None
Experiment transcriptomics None
Organism Salmon None
Project HoloFood None
Sample code SB01.05B1a None

Treatment metadata

Marker Measurement Units
Treatment code Mars None
Treatment concentration 0.0% %
Treatment description Sanford Blue Mussel Meal None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SB None
Trial description Trial B: Blue mussel-dose response None
Trial end 2019-11-22 None
Trial start 2019-08-14 None
Nucleotide sequencing data

Sample SAMEA112369711 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 13,618,686,525bp sequenced by 91,242,006 reads. View sample SAMEA112369711 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112369711 SB01.05B1a
Reads (Run) ERR10808187 webin-reads-SB01_05B1a_hostT
Reads (Experiment) ERX10257772 Illumina NovaSeq 6000 sequencing: Raw reads: SB01_05B1a_hostT
Project/Study PRJEB59276 HoloFood Salmon Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369711