Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112369706, a HoloFood transcriptomic salmon sample
Metadata for sample SAMEA112369706, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA112369706 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:24:21Z | None |
INSDC last update | 2023-03-22T12:24:21Z | None |
INSDC status | public | None |
SRA accession | ERS14480024 | None |
Submitter Id | SA12_05B1a_hostT | None |
adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
collection date | 2019-06-11 | None |
common name | Atlantic salmon | None |
description | Salmon host transcriptome data from Distal gut tissue; animal SA12.05 from tank SA12 with treatment Cougar | None |
geographic location (country and/or sea) | Norway | None |
geographic location (latitude) | 66.08 | DD |
geographic location (longitude) | 12.588 | DD |
geographic location (region and locality) | Dønna; Nordland county | None |
host body site | Distal gut tissue | None |
host common name | Atlantic salmon | None |
host diet | Fermented algae meal (added in in oil coating) | None |
host diet treatment | Cougar SA Seaweed 1.5% | None |
host diet treatment concentration | 0 | % mass |
host disease status | Wounded:- | None |
host gutted mass | 231.8 | g |
host length | 27 | cm |
host scientific name | Salmo salar | None |
host storage container | LetSea Tank: Cougar | None |
host storage container pH | 7.05 | None |
host storage container temperature | 12.76 | °C |
host subject id | SA12.05 | None |
host taxid | 8030 | None |
host total mass | 273.4 | g |
library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
library selection | rRNA depletion + strand specific library | None |
nucleic acid extraction | D-rex protocol | None |
organism | Salmo salar | None |
project | HoloFood | None |
project name | HoloFood Salmon - Host Transcriptome | None |
reference host genome for decontamination | GCA_000000000.0 | None |
sample storage buffer | RNAlater | None |
sample storage container | 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Salmo salar | None |
sequencing method | Illumina Novaseq 6000 | None |
title | SA12.05B1a | None |
trial timepoint | 0 | day |
Marker | Measurement | Units |
---|---|---|
Body site | distal gut tissue | None |
Experiment | transcriptomics | None |
Organism | Salmon | None |
Project | HoloFood | None |
Sample code | SA12.05B1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | Cougar | None |
Treatment concentration | 1.5% | % |
Treatment description | Fermented algae meal (added in in oil coating) | None |
Marker | Measurement | Units |
---|---|---|
Environment | Tanks (flow-through) | None |
Trial code | SA | None |
Trial description | Trial A: Seaweed-dose response | None |
Trial end | 2019-08-13 | None |
Trial start | 2019-06-11 | None |
Sample SAMEA112369706 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 13,840,073,233bp sequenced by 92,685,588 reads. View sample SAMEA112369706 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA112369706 | SA12.05B1a |
Reads (Run) | ERR10808961 | webin-reads-SA12_05B1a_hostT |
Reads (Experiment) | ERX10258546 | Illumina NovaSeq 6000 sequencing: Raw reads: SA12_05B1a_hostT |
Project/Study | PRJEB59276 | HoloFood Salmon Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369706