Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112369634, a HoloFood transcriptomic salmon sample
Metadata for sample SAMEA112369634, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units | 
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None | 
| ENA-FIRST-PUBLIC | 2023-03-22 | None | 
| ENA-LAST-UPDATE | 2023-03-22 | None | 
| External Id | SAMEA112369634 | None | 
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None | 
| INSDC center name | UNIVERSITY OF COPENHAGEN | None | 
| INSDC first public | 2023-03-22T12:24:22Z | None | 
| INSDC last update | 2023-03-22T12:24:22Z | None | 
| INSDC status | public | None | 
| SRA accession | ERS14479952 | None | 
| Submitter Id | SA07_22B1a_hostT | None | 
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None | 
| collection date | 2019-08-12 | None | 
| common name | Atlantic salmon | None | 
| description | Salmon host transcriptome data from Distal gut tissue; animal SA07.22 from tank SA07 with treatment Jaguar | None | 
| geographic location (country and/or sea) | Norway | None | 
| geographic location (latitude) | 66.08 | DD | 
| geographic location (longitude) | 12.588 | DD | 
| geographic location (region and locality) | Dønna; Nordland county | None | 
| host body site | Distal gut tissue | None | 
| host common name | Atlantic salmon | None | 
| host diet | Fermented algae meal (added in in oil coating) | None | 
| host diet treatment | Jaguar SA Seaweed 2% | None | 
| host diet treatment concentration | 2 | % mass | 
| host disease status | Wounded:- | None | 
| host gutted mass | 574.4 | g | 
| host length | 38 | cm | 
| host scientific name | Salmo salar | None | 
| host storage container | LetSea Tank: Jaguar | None | 
| host storage container pH | 7.05 | None | 
| host storage container temperature | 12.76 | °C | 
| host subject id | SA07.22 | None | 
| host taxid | 8030 | None | 
| host total mass | 667.8 | g | 
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None | 
| library selection | rRNA depletion + strand specific library | None | 
| nucleic acid extraction | D-rex protocol | None | 
| organism | Salmo salar | None | 
| project | HoloFood | None | 
| project name | HoloFood Salmon - Host Transcriptome | None | 
| reference host genome for decontamination | GCA_000000000.0 | None | 
| sample storage buffer | RNAlater | None | 
| sample storage container | 2ml | None | 
| sample storage location | UCPH | None | 
| sample storage temperature | -20 | °C | 
| sample volume or weight for DNA extraction | 0.2 | mL | 
| scientific_name | Salmo salar | None | 
| sequencing method | Illumina Novaseq 6000 | None | 
| title | SA07.22B1a | None | 
| trial timepoint | 60 | day | 
| Marker | Measurement | Units | 
|---|---|---|
| Body site | distal gut tissue | None | 
| Experiment | transcriptomics | None | 
| Organism | Salmon | None | 
| Project | HoloFood | None | 
| Sample code | SA07.22B1a | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Treatment code | Jaguar | None | 
| Treatment concentration | 2.0% | % | 
| Treatment description | Fermented algae meal (added in in oil coating) | None | 
| Marker | Measurement | Units | 
|---|---|---|
| Environment | Tanks (flow-through) | None | 
| Trial code | SA | None | 
| Trial description | Trial A: Seaweed-dose response | None | 
| Trial end | 2019-08-13 | None | 
| Trial start | 2019-06-11 | None | 
Sample SAMEA112369634 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 12,195,791,022bp sequenced by 81,583,248 reads. View sample SAMEA112369634 in ENA
| Data domain | Accession | Title/alias | 
|---|---|---|
| Sample | SAMEA112369634 | SA07.22B1a | 
| Reads (Run) | ERR10808268 | webin-reads-SA07_22B1a_hostT | 
| Reads (Experiment) | ERX10257853 | Illumina NovaSeq 6000 sequencing: Raw reads: SA07_22B1a_hostT | 
| Project/Study | PRJEB59276 | HoloFood Salmon Host Transcriptome | 
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369634