HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112369582: SA03.02B1a

Sample data for SAMEA112369582, a HoloFood transcriptomic salmon sample


Sample details
Animal
Salmon SAMEA112948505
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA112369582 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112369582, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA112369582 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:24:20Z None
INSDC last update 2023-03-22T12:24:20Z None
INSDC status public None
SRA accession ERS14479900 None
Submitter Id SA03_02B1a_hostT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-06-11 None
common name Atlantic salmon None
description Salmon host transcriptome data from Distal gut tissue; animal SA03.02 from tank SA03 with treatment Lion None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut tissue None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Lion SA Seaweed 1% None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 239.4 g
host length 28.5 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Lion None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA03.02 None
host taxid 8030 None
host total mass 279 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Transcriptome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer RNAlater None
sample storage container 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method Illumina Novaseq 6000 None
title SA03.02B1a None
trial timepoint 0 day

Sample metadata

Marker Measurement Units
Body site distal gut tissue None
Experiment transcriptomics None
Organism Salmon None
Project HoloFood None
Sample code SA03.02B1a None

Treatment metadata

Marker Measurement Units
Treatment code Lion None
Treatment concentration 1.0% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Nucleotide sequencing data

Sample SAMEA112369582 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 11,876,469,457bp sequenced by 79,476,008 reads. View sample SAMEA112369582 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112369582 SA03.02B1a
Reads (Run) ERR10808143 webin-reads-SA03_02B1a_hostT
Reads (Experiment) ERX10257728 Illumina NovaSeq 6000 sequencing: Raw reads: SA03_02B1a_hostT
Project/Study PRJEB59276 HoloFood Salmon Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369582