HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA112369552, a HoloFood transcriptomic salmon sample
Metadata for sample SAMEA112369552, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA112369552 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:24:19Z | None |
| INSDC last update | 2023-03-22T12:24:19Z | None |
| INSDC status | public | None |
| SRA accession | ERS14479871 | None |
| Submitter Id | SA01_21B1a_hostT | None |
| adapters | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | None |
| collection date | 2019-08-12 | None |
| common name | Atlantic salmon | None |
| description | Salmon host transcriptome data from Distal gut tissue; animal SA01.21 from tank SA01 with treatment Tiger | None |
| geographic location (country and/or sea) | Norway | None |
| geographic location (latitude) | 66.08 | DD |
| geographic location (longitude) | 12.588 | DD |
| geographic location (region and locality) | Dønna; Nordland county | None |
| host body site | Distal gut tissue | None |
| host common name | Atlantic salmon | None |
| host diet | Fermented algae meal (added in in oil coating) | None |
| host diet treatment | Tiger SA Seaweed 0% | None |
| host diet treatment concentration | 0 | % mass |
| host disease status | Wounded:- | None |
| host gutted mass | 481.8 | g |
| host length | 34.5 | cm |
| host scientific name | Salmo salar | None |
| host storage container | LetSea Tank: Tiger | None |
| host storage container pH | 7.05 | None |
| host storage container temperature | 12.76 | °C |
| host subject id | SA01.21 | None |
| host taxid | 8030 | None |
| host total mass | 572.2 | g |
| library name | Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit | None |
| library selection | rRNA depletion + strand specific library | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Salmo salar | None |
| project | HoloFood | None |
| project name | HoloFood Salmon - Host Transcriptome | None |
| reference host genome for decontamination | GCA_000000000.0 | None |
| sample storage buffer | RNAlater | None |
| sample storage container | 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Salmo salar | None |
| sequencing method | Illumina Novaseq 6000 | None |
| title | SA01.21B1a | None |
| trial timepoint | 60 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | distal gut tissue | None |
| Experiment | transcriptomics | None |
| Organism | Salmon | None |
| Project | HoloFood | None |
| Sample code | SA01.21B1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | Tiger | None |
| Treatment concentration | 0.0% | % |
| Treatment description | Fermented algae meal (added in in oil coating) | None |
| Marker | Measurement | Units |
|---|---|---|
| Environment | Tanks (flow-through) | None |
| Trial code | SA | None |
| Trial description | Trial A: Seaweed-dose response | None |
| Trial end | 2019-08-13 | None |
| Trial start | 2019-06-11 | None |
Sample SAMEA112369552 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 13,217,472,327bp sequenced by 88,343,228 reads. View sample SAMEA112369552 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA112369552 | SA01.21B1a |
| Reads (Run) | ERR10808110 | webin-reads-SA01_21B1a_hostT |
| Reads (Experiment) | ERX10257695 | Illumina NovaSeq 6000 sequencing: Raw reads: SA01_21B1a_hostT |
| Project/Study | PRJEB59276 | HoloFood Salmon Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369552
