HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA112369541: SA01.01B1a

Sample data for SAMEA112369541, a HoloFood transcriptomic salmon sample


Sample details
Animal
Salmon SAMEA112949440
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA112369541 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA112369541, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA112369541 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:24:21Z None
INSDC last update 2023-03-22T12:24:21Z None
INSDC status public None
SRA accession ERS14479860 None
Submitter Id SA01_01B1a_hostT None
adapters AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT None
collection date 2019-06-11 None
common name Atlantic salmon None
description Salmon host transcriptome data from Distal gut tissue; animal SA01.01 from tank SA01 with treatment Tiger None
geographic location (country and/or sea) Norway None
geographic location (latitude) 66.08 DD
geographic location (longitude) 12.588 DD
geographic location (region and locality) Dønna; Nordland county None
host body site Distal gut tissue None
host common name Atlantic salmon None
host diet Fermented algae meal (added in in oil coating) None
host diet treatment Tiger SA Seaweed 0% None
host diet treatment concentration 0 % mass
host disease status Wounded:- None
host gutted mass 260.4 g
host length 29.8 cm
host scientific name Salmo salar None
host storage container LetSea Tank: Tiger None
host storage container pH 7.05 None
host storage container temperature 12.76 °C
host subject id SA01.01 None
host taxid 8030 None
host total mass 294.2 g
library name Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit None
library selection rRNA depletion + strand specific library None
nucleic acid extraction D-rex protocol None
organism Salmo salar None
project HoloFood None
project name HoloFood Salmon - Host Transcriptome None
reference host genome for decontamination GCA_000000000.0 None
sample storage buffer RNAlater None
sample storage container 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Salmo salar None
sequencing method Illumina Novaseq 6000 None
title SA01.01B1a None
trial timepoint 0 day

Sample metadata

Marker Measurement Units
Body site distal gut tissue None
Experiment transcriptomics None
Organism Salmon None
Project HoloFood None
Sample code SA01.01B1a None

Treatment metadata

Marker Measurement Units
Treatment code Tiger None
Treatment concentration 0.0% %
Treatment description Fermented algae meal (added in in oil coating) None

Trial metadata

Marker Measurement Units
Environment Tanks (flow-through) None
Trial code SA None
Trial description Trial A: Seaweed-dose response None
Trial end 2019-08-13 None
Trial start 2019-06-11 None
Nucleotide sequencing data

Sample SAMEA112369541 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 11,871,047,619bp sequenced by 79,374,710 reads. View sample SAMEA112369541 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA112369541 SA01.01B1a
Reads (Run) ERR10808251 webin-reads-SA01_01B1a_hostT
Reads (Experiment) ERX10257836 Illumina NovaSeq 6000 sequencing: Raw reads: SA01_01B1a_hostT
Project/Study PRJEB59276 HoloFood Salmon Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA112369541