HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA110346489: CA05.08E1a

Sample data for SAMEA110346489, a HoloFood transcriptomic chicken sample


Sample details
Animal
Chicken SAMEA112905061
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA110346489 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA110346489, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA110346489 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:50Z None
INSDC last update 2023-03-22T12:22:50Z None
INSDC status public None
SRA accession ERS12443570 None
Submitter Id CA05_08E1a_RAW_HostT None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-02-25 None
common name chicken None
description Chicken meta genome data from Caecum mucosa; animal CA05.08 from cage CA05 with treatment CE None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum mucosa None
host breed Ross None
host common name Chicken None
host diet treatment Prebiotic None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CA05.08 None
host taxid 9031 None
host total mass 683.6 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Transcriptome None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method Illumiva Novaseq 6000 None
title CA05.08E1a None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site caecum mucosa None
Experiment transcriptomics None
Organism Chicken None
Project HoloFood None
Sample code CA05.08E1a None

Treatment metadata

Marker Measurement Units
Treatment code CE None
Treatment name Prebiotic None

Trial metadata

Marker Measurement Units
Trial code CA None
Trial description Trial 1 None
Trial end 2019-03-11 None
Trial start 2019-02-04 None
Nucleotide sequencing data

Sample SAMEA110346489 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,081,235,300bp sequenced by 33,874,902 reads. View sample SAMEA110346489 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA110346489 CA05.08E1a
Reads (Run) ERR9951685 webin-reads-CA05_08E1a_raw_HostT
Reads (Experiment) ERX9495105 Illumina NovaSeq 6000 sequencing: Raw reads: CA05_08E1a_raw_HostT
Project/Study PRJEB52095 HoloFood Chicken Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA110346489