HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA110346484, a HoloFood transcriptomic chicken sample
Metadata for sample SAMEA110346484, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA110346484 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:22:50Z | None |
| INSDC last update | 2023-03-22T12:22:50Z | None |
| INSDC status | public | None |
| SRA accession | ERS12443565 | None |
| Submitter Id | CA03_14B1a_RAW_HostT | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-03-11 | None |
| common name | chicken | None |
| description | Chicken meta genome data from Ileum mucosa; animal CA03.14 from cage CA03 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Ileum mucosa | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | female | None |
| host storage container temperature | 21 | °C |
| host subject id | CA03.14 | None |
| host taxid | 9031 | None |
| host total mass | 2164 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | Gallus gallus | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Host Transcriptome | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | Gallus gallus | None |
| sequencing method | Illumiva Novaseq 6000 | None |
| title | CA03.14B1a | None |
| trial length | 35 | day |
| trial timepoint | 35 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | ileum mucosa | None |
| Experiment | transcriptomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CA03.14B1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CA | None |
| Trial description | Trial 1 | None |
| Trial end | 2019-03-11 | None |
| Trial start | 2019-02-04 | None |
Sample SAMEA110346484 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,512,087,500bp sequenced by 36,747,250 reads. View sample SAMEA110346484 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA110346484 | CA03.14B1a |
| Reads (Run) | ERR9939723 | webin-reads-CA03_14B1a_raw_HostT |
| Reads (Experiment) | ERX9483165 | Illumina NovaSeq 6000 sequencing: Raw reads: CA03_14B1a_raw_HostT |
| Project/Study | PRJEB52095 | HoloFood Chicken Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA110346484
