Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA110346482, a HoloFood transcriptomic chicken sample
Metadata for sample SAMEA110346482, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA110346482 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:22:50Z | None |
INSDC last update | 2023-03-22T12:22:50Z | None |
INSDC status | public | None |
SRA accession | ERS12443563 | None |
Submitter Id | CA01_10B1a_RAW_HostT | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
collection date | 2019-02-26 | None |
common name | chicken | None |
description | Chicken meta genome data from Ileum mucosa; animal CA01.10 from cage CA01 with treatment CC | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Ileum mucosa | None |
host breed | Cobb | None |
host common name | Chicken | None |
host diet treatment | Control | None |
host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
host scientific name | Gallus gallus | None |
host sex | male | None |
host storage container temperature | 21 | °C |
host subject id | CA01.10 | None |
host taxid | 9031 | None |
host total mass | 1095.2 | g |
library name | BEMT | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | Gallus gallus | None |
project | HoloFood | None |
project name | HoloFood Chicken - Host Transcriptome | None |
reference host genome for decontamination | GCF_000002315.6 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | Gallus gallus | None |
sequencing method | Illumiva Novaseq 6000 | None |
title | CA01.10B1a | None |
trial length | 35 | day |
trial timepoint | 21 | day |
Marker | Measurement | Units |
---|---|---|
Body site | ileum mucosa | None |
Experiment | transcriptomics | None |
Organism | Chicken | None |
Project | HoloFood | None |
Sample code | CA01.10B1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CC | None |
Treatment name | Control | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CA | None |
Trial description | Trial 1 | None |
Trial end | 2019-03-11 | None |
Trial start | 2019-02-04 | None |
Sample SAMEA110346482 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,389,565,100bp sequenced by 35,930,434 reads. View sample SAMEA110346482 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA110346482 | CA01.10B1a |
Reads (Run) | ERR9951724 | webin-reads-CA01_10B1a_raw_HostT |
Reads (Experiment) | ERX9495144 | Illumina NovaSeq 6000 sequencing: Raw reads: CA01_10B1a_raw_HostT |
Project/Study | PRJEB52095 | HoloFood Chicken Host Transcriptome |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA110346482