HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA110346482: CA01.10B1a

Sample data for SAMEA110346482, a HoloFood transcriptomic chicken sample


Sample details
Animal
Chicken SAMEA112905098
Sample type
Host transcriptome data icon transcriptomic
API endpoint
/api/samples/SAMEA110346482 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA110346482, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA110346482 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:22:50Z None
INSDC last update 2023-03-22T12:22:50Z None
INSDC status public None
SRA accession ERS12443563 None
Submitter Id CA01_10B1a_RAW_HostT None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-02-26 None
common name chicken None
description Chicken meta genome data from Ileum mucosa; animal CA01.10 from cage CA01 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Ileum mucosa None
host breed Cobb None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CA01.10 None
host taxid 9031 None
host total mass 1095.2 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism Gallus gallus None
project HoloFood None
project name HoloFood Chicken - Host Transcriptome None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name Gallus gallus None
sequencing method Illumiva Novaseq 6000 None
title CA01.10B1a None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site ileum mucosa None
Experiment transcriptomics None
Organism Chicken None
Project HoloFood None
Sample code CA01.10B1a None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CA None
Trial description Trial 1 None
Trial end 2019-03-11 None
Trial start 2019-02-04 None
Nucleotide sequencing data

Sample SAMEA110346482 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,389,565,100bp sequenced by 35,930,434 reads. View sample SAMEA110346482 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA110346482 CA01.10B1a
Reads (Run) ERR9951724 webin-reads-CA01_10B1a_raw_HostT
Reads (Experiment) ERX9495144 Illumina NovaSeq 6000 sequencing: Raw reads: CA01_10B1a_raw_HostT
Project/Study PRJEB52095 HoloFood Chicken Host Transcriptome

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA110346482