HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA10158040, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA10158040, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA10158040 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:57Z | None |
| INSDC last update | 2023-03-22T12:21:57Z | None |
| INSDC status | public | None |
| SRA accession | ERS7814527 | None |
| Submitter Id | CC18_12C1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-10-01 | None |
| common name | Chicken Gut Metagenome | None |
| description | Chicken gut metagenomic data from Ileum content; animal CC18.12 from cage CC18 with treatment CO | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Ileum content | None |
| host breed | Ross | None |
| host common name | Chicken | None |
| host diet treatment | Probiotic | None |
| host disease status | Campylobacter:+;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | male | None |
| host storage container temperature | 21 | °C |
| host subject id | CC18.12 | None |
| host taxid | 9031 | None |
| host total mass | 814 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Priority chicken ileum content | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CC18.12C1a | None |
| trial length | 35 | day |
| trial timepoint | 21 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | ileum content | None |
| Experiment | metagenomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CC18.12C1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CO | None |
| Treatment name | Probiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA10158040 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|---|---|---|---|
| MGYA00606568 | ERR6800368 | 5.0 | metagenomic | View on MGnify |
| MGYA00617012 | ERZ11806508 | 5.0 | assembly | View on MGnify |
Sample SAMEA10158040 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 1,064,741,647bp sequenced by 7,570,912 reads. View sample SAMEA10158040 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA10158040 | CC18.12C1a |
| Reads (Run) | ERR6800368 | webin-reads-CC18_12C1a_metaG |
| Reads (Experiment) | ERX6424016 | DNBSEQ-G400 sequencing: Raw reads: CC18_12C1a_metaG |
| Project/Study | PRJEB47609 | HoloFood Chicken Ileum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10158040
