Could not connect to MGnify right now. Please try later.
HoloFood Data Portal
Access samples and data collected and generated by the HoloFood project.
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA10158035, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA10158035, stored in BioSamples and ENA.
Download all as TSV| Marker | Measurement | Units |
|---|---|---|
| ENA-CHECKLIST | ERC000052 | None |
| ENA-FIRST-PUBLIC | 2023-03-22 | None |
| ENA-LAST-UPDATE | 2023-03-22 | None |
| External Id | SAMEA10158035 | None |
| INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
| INSDC center name | UNIVERSITY OF COPENHAGEN | None |
| INSDC first public | 2023-03-22T12:21:57Z | None |
| INSDC last update | 2023-03-22T12:21:57Z | None |
| INSDC status | public | None |
| SRA accession | ERS7814522 | None |
| Submitter Id | CC13_04C1a_metaG | None |
| adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
| collection date | 2019-09-17 | None |
| common name | Chicken Gut Metagenome | None |
| description | Chicken gut metagenomic data from Ileum content; animal CC13.04 from cage CC13 with treatment CE | None |
| geographic location (country and/or sea) | Spain | None |
| geographic location (latitude) | 41.17 | DD |
| geographic location (longitude) | 1.1685 | DD |
| geographic location (region and locality) | El Morell; Tarragona | None |
| host body site | Ileum content | None |
| host breed | Cobb | None |
| host common name | Chicken | None |
| host diet treatment | Prebiotic | None |
| host disease status | Campylobacter:-;Salmonella:-;Clostridium:- | None |
| host scientific name | Gallus gallus | None |
| host sex | female | None |
| host storage container temperature | 21 | °C |
| host subject id | CC13.04 | None |
| host taxid | 9031 | None |
| host total mass | 209.3 | g |
| library name | BEMT | None |
| library selection | PCR | None |
| nucleic acid extraction | D-rex protocol | None |
| organism | chicken gut metagenome | None |
| project | HoloFood | None |
| project name | HoloFood Chicken - Priority chicken ileum content | None |
| reference host genome for decontamination | GCF_000002315.6 | None |
| sample storage buffer | Shield | None |
| sample storage container | E-matrix 2ml | None |
| sample storage location | UCPH | None |
| sample storage temperature | -20 | °C |
| sample volume or weight for DNA extraction | 0.2 | mL |
| scientific_name | chicken gut metagenome | None |
| sequencing method | MGISEQ-2000 | None |
| title | CC13.04C1a | None |
| trial length | 35 | day |
| trial timepoint | 7 | day |
| Marker | Measurement | Units |
|---|---|---|
| Body site | ileum content | None |
| Experiment | metagenomics | None |
| Organism | Chicken | None |
| Project | HoloFood | None |
| Sample code | CC13.04C1a | None |
| Marker | Measurement | Units |
|---|---|---|
| Treatment code | CE | None |
| Treatment name | Prebiotic | None |
| Marker | Measurement | Units |
|---|---|---|
| Trial code | CC | None |
| Trial description | Trial 3 | None |
| Trial end | 2019-07-14 | None |
| Trial start | 2019-06-09 | None |
Sample SAMEA10158035 may have been analysed by MGnify. Lookup sample on MGnify
| Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
|---|
No analyses found in MGnify
Sample SAMEA10158035 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 9,283,832,503bp sequenced by 66,094,144 reads. View sample SAMEA10158035 in ENA
| Data domain | Accession | Title/alias |
|---|---|---|
| Sample | SAMEA10158035 | CC13.04C1a |
| Reads (Run) | ERR6800380 | webin-reads-CC13_04C1a_metaG |
| Reads (Experiment) | ERX6424028 | DNBSEQ-G400 sequencing: Raw reads: CC13_04C1a_metaG |
| Project/Study | PRJEB47609 | HoloFood Chicken Ileum Metagenome – deeply sequenced batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10158035