HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA10130109: CC17.11C1a

Sample data for SAMEA10130109, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112905225
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA10130109 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA10130109, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA10130109 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:56Z None
INSDC last update 2023-03-22T12:21:56Z None
INSDC status public None
SRA accession ERS7786636 None
Submitter Id CC17_11C1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-10-01 None
common name Chicken Gut Metagenome None
description Chicken gut metagenomic data from Ileum content; animal CC17.11 from cage CC17 with treatment CC None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Ileum content None
host breed Cobb None
host common name Chicken None
host diet treatment Control None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CC17.11 None
host taxid 9031 None
host total mass 948 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - Prior Chicken Ileum Content None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method MGISEQ-2000 None
title CC17.11C1a None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site ileum content None
Experiment metagenomics None
Organism Chicken None
Project HoloFood None
Sample code CC17.11C1a None

Treatment metadata

Marker Measurement Units
Treatment code CC None
Treatment name Control None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Metagenomics

Sample SAMEA10130109 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00606555 ERR6769665 5.0 metagenomic View on MGnify
MGYA00617032 ERZ11806485 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA10130109 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 5,184,711,944bp sequenced by 38,151,938 reads. View sample SAMEA10130109 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA10130109 CC17.11C1a
Reads (Run) ERR6769665 webin-reads-CC17_11C1a_metaG
Reads (Experiment) ERX6393447 DNBSEQ-G400 sequencing: Raw reads: CC17_11C1a_metaG
Project/Study PRJEB47609 HoloFood Chicken Ileum Metagenome – deeply sequenced batch

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10130109