HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA10130054: CC02.09C1a

Sample data for SAMEA10130054, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112904912
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA10130054 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA10130054, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA10130054 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:56Z None
INSDC last update 2023-03-22T12:21:56Z None
INSDC status public None
SRA accession ERS7786581 None
Submitter Id CC02_09C1a_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-09-30 None
common name Chicken Gut Metagenome None
description Chicken gut metagenomic data from Ileum content; animal CC02.09 from cage CC02 with treatment CO None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Ileum content None
host breed Cobb None
host common name Chicken None
host diet treatment Probiotic None
host disease status Campylobacter:+;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex female None
host storage container temperature 21 °C
host subject id CC02.09 None
host taxid 9031 None
host total mass 948 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - Prior Chicken Ileum Content None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method MGISEQ-2000 None
title CC02.09C1a None
trial length 35 day
trial timepoint 21 day

Sample metadata

Marker Measurement Units
Body site ileum content None
Experiment metagenomics None
Organism Chicken None
Project HoloFood None
Sample code CC02.09C1a None

Treatment metadata

Marker Measurement Units
Treatment code CO None
Treatment name Probiotic None

Trial metadata

Marker Measurement Units
Trial code CC None
Trial description Trial 3 None
Trial end 2019-07-14 None
Trial start 2019-06-09 None
Metagenomics

Sample SAMEA10130054 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
MGYA00608283 ERR6769648 5.0 metagenomic View on MGnify
MGYA00616977 ERZ11806544 5.0 assembly View on MGnify
Nucleotide sequencing data

Sample SAMEA10130054 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 1,513,443,465bp sequenced by 10,800,066 reads. View sample SAMEA10130054 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA10130054 CC02.09C1a
Reads (Run) ERR6769648 webin-reads-CC02_09C1a_metaG
Reads (Experiment) ERX6393430 DNBSEQ-G400 sequencing: Raw reads: CC02_09C1a_metaG
Project/Study PRJEB47609 HoloFood Chicken Ileum Metagenome – deeply sequenced batch

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10130054