No analyses found in MGnify
Access samples and data collected and generated by the HoloFood project.
Sample data for SAMEA10104930, a HoloFood metagenomic-assembly chicken sample
Metadata for sample SAMEA10104930, stored in BioSamples and ENA.
Download all as TSVMarker | Measurement | Units |
---|---|---|
ENA-CHECKLIST | ERC000052 | None |
ENA-FIRST-PUBLIC | 2023-03-22 | None |
ENA-LAST-UPDATE | 2023-03-22 | None |
External Id | SAMEA10104930 | None |
INSDC center alias | UNIVERSITY OF COPENHAGEN | None |
INSDC center name | UNIVERSITY OF COPENHAGEN | None |
INSDC first public | 2023-03-22T12:21:55Z | None |
INSDC last update | 2023-03-22T12:21:55Z | None |
INSDC status | public | None |
SRA accession | ERS7761559 | None |
Submitter Id | CA14_03F1a_EC_metaG | None |
adapters | AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC | None |
collection date | 2019-02-11 | None |
common name | Chicken Gut Metagenome | None |
description | Chicken gut metagenomic data from Caecum content; animal CA14.03 from cage CA14 with treatment CC | None |
geographic location (country and/or sea) | Spain | None |
geographic location (latitude) | 41.17 | DD |
geographic location (longitude) | 1.1685 | DD |
geographic location (region and locality) | El Morell; Tarragona | None |
host body site | Caecum content | None |
host breed | Ross | None |
host common name | Chicken | None |
host diet treatment | Control | None |
host disease status | Campylobacter:NS;Salmonella:NS;Clostridium:NS | None |
host scientific name | Gallus gallus | None |
host sex | female | None |
host storage container temperature | 21 | °C |
host subject id | CA14.03 | None |
host taxid | 9031 | None |
host total mass | 169.2 | g |
library name | BEMT | None |
library selection | PCR | None |
nucleic acid extraction | D-rex protocol | None |
organism | chicken gut metagenome | None |
project | HoloFood | None |
project name | HoloFood Chicken - Extreme Chicken | None |
reference host genome for decontamination | GCF_000002315.6 | None |
sample storage buffer | Shield | None |
sample storage container | E-matrix 2ml | None |
sample storage location | UCPH | None |
sample storage temperature | -20 | °C |
sample volume or weight for DNA extraction | 0.2 | mL |
scientific_name | chicken gut metagenome | None |
sequencing method | MGISEQ-2000 | None |
title | CA14.03F1a | None |
trial length | 35 | day |
trial timepoint | 7 | day |
Marker | Measurement | Units |
---|---|---|
Body site | caecum content | None |
Experiment | metagenomics | None |
Organism | Chicken | None |
Project | HoloFood | None |
Sample code | CA14.03F1a | None |
Marker | Measurement | Units |
---|---|---|
Treatment code | CC | None |
Treatment name | Control | None |
Marker | Measurement | Units |
---|---|---|
Trial code | CA | None |
Trial description | Trial 1 | None |
Trial end | 2019-03-11 | None |
Trial start | 2019-02-04 | None |
Sample SAMEA10104930 may have been analysed by MGnify. Lookup sample on MGnify
Analysis accession | Run/assembly accession | MGnify pipeline version | Experiment type | Detail |
---|
No analyses found in MGnify
Sample SAMEA10104930 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 6,440,435,120bp sequenced by 43,838,226 reads. View sample SAMEA10104930 in ENA
Data domain | Accession | Title/alias |
---|---|---|
Sample | SAMEA10104930 | CA14.03F1a |
Reads (Run) | ERR6747856 | webin-reads-CA14_03F1a_EC_metaG |
Reads (Experiment) | ERX6371914 | DNBSEQ-G400 sequencing: Raw reads: CA14_03F1a_EC_metaG |
Project/Study | PRJEB46550 | HoloFood Chicken Caecum Metagenome – extreme sizes batch |
Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10104930