HoloFood Data Portal

Access samples and data collected and generated by the HoloFood project.

SAMEA10104921: CA07.14F1a

Sample data for SAMEA10104921, a HoloFood metagenomic-assembly chicken sample


Sample details
Animal
Chicken SAMEA112905172
Sample type
Metagenomic / metatranscriptomic data icon metagenomic-assembly
API endpoint
/api/samples/SAMEA10104921 Copy API Endpoint
Sample metadata

Metadata for sample SAMEA10104921, stored in BioSamples and ENA.

 Download all as TSV

Ena Checklist metadata

Marker Measurement Units
ENA-CHECKLIST ERC000052 None
ENA-FIRST-PUBLIC 2023-03-22 None
ENA-LAST-UPDATE 2023-03-22 None
External Id SAMEA10104921 None
INSDC center alias UNIVERSITY OF COPENHAGEN None
INSDC center name UNIVERSITY OF COPENHAGEN None
INSDC first public 2023-03-22T12:21:55Z None
INSDC last update 2023-03-22T12:21:55Z None
INSDC status public None
SRA accession ERS7761550 None
Submitter Id CA07_14F1a_EC_metaG None
adapters AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC None
collection date 2019-03-11 None
common name Chicken Gut Metagenome None
description Chicken gut metagenomic data from Caecum content; animal CA07.14 from cage CA07 with treatment CE None
geographic location (country and/or sea) Spain None
geographic location (latitude) 41.17 DD
geographic location (longitude) 1.1685 DD
geographic location (region and locality) El Morell; Tarragona None
host body site Caecum content None
host breed Cobb None
host common name Chicken None
host diet treatment Prebiotic None
host disease status Campylobacter:-;Salmonella:-;Clostridium:- None
host scientific name Gallus gallus None
host sex male None
host storage container temperature 21 °C
host subject id CA07.14 None
host taxid 9031 None
host total mass 2622.8 g
library name BEMT None
library selection PCR None
nucleic acid extraction D-rex protocol None
organism chicken gut metagenome None
project HoloFood None
project name HoloFood Chicken - Extreme Chicken None
reference host genome for decontamination GCF_000002315.6 None
sample storage buffer Shield None
sample storage container E-matrix 2ml None
sample storage location UCPH None
sample storage temperature -20 °C
sample volume or weight for DNA extraction 0.2 mL
scientific_name chicken gut metagenome None
sequencing method MGISEQ-2000 None
title CA07.14F1a None
trial length 35 day
trial timepoint 35 day

Sample metadata

Marker Measurement Units
Body site caecum content None
Experiment metagenomics None
Organism Chicken None
Project HoloFood None
Sample code CA07.14F1a None

Treatment metadata

Marker Measurement Units
Treatment code CE None
Treatment name Prebiotic None

Trial metadata

Marker Measurement Units
Trial code CA None
Trial description Trial 1 None
Trial end 2019-03-11 None
Trial start 2019-02-04 None
Metagenomics

Sample SAMEA10104921 may have been analysed by MGnify. Lookup sample on MGnify

Analyses

Empty set icon

Could not connect to MGnify right now. Please try later.

Analysis accession Run/assembly accession MGnify pipeline version Experiment type Detail
Empty set icon

No analyses found in MGnify

Nucleotide sequencing data

Sample SAMEA10104921 has nucleotide sequencing data in the European Nucleotide Archive (ENA): 4,434,934,501bp sequenced by 30,263,850 reads. View sample SAMEA10104921 in ENA

Related records in ENA

Data domain Accession Title/alias
Sample SAMEA10104921 CA07.14F1a
Reads (Run) ERR6748423 webin-reads-CA07_14F1a_EC_metaG
Reads (Experiment) ERX6372371 DNBSEQ-G400 sequencing: Raw reads: CA07_14F1a_EC_metaG
Project/Study PRJEB46550 HoloFood Chicken Caecum Metagenome – extreme sizes batch

Analysis summaries

Documents written by HoloFood partners and collaborators relevant to Sample SAMEA10104921