marker__name	marker__type	marker__canonical_url	measurement	units
ENA-CHECKLIST	ENA Checklist		ERC000052	
ENA-FIRST-PUBLIC	ENA Checklist		2023-03-22	
ENA-LAST-UPDATE	ENA Checklist		2023-03-22	
External Id	ENA Checklist		SAMEA9068849	
INSDC center alias	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC center name	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC first public	ENA Checklist		2023-03-22T12:21:42Z	
INSDC last update	ENA Checklist		2023-03-22T12:21:42Z	
INSDC status	ENA Checklist		public	
SRA accession	ENA Checklist		ERS6797168	
Submitter Id	ENA Checklist		SB01_23C1a_hostG	
adapters	ENA Checklist		AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT	
collection date	ENA Checklist		2019-10-14	
common name	ENA Checklist		Atlantic salmon	
description	ENA Checklist		Salmon host genomic data from Distal gut content; animal SB01.23 from tank SB01 with treatment Mars	
geographic location (country and/or sea)	ENA Checklist		Norway	
geographic location (latitude)	ENA Checklist		66.079905	DD
geographic location (longitude)	ENA Checklist		12.587848	DD
geographic location (region and locality)	ENA Checklist		Dønna; Nordland county	
host body site	ENA Checklist		Distal gut content	
host common name	ENA Checklist		Atlantic salmon	
host diet	ENA Checklist		Sanford Blue Mussel Meal	
host diet treatment	ENA Checklist		Mars: SB Control	
host diet treatment concentration	ENA Checklist		0	% mass
host disease status	ENA Checklist		Wounded:-	
host gutted mass	ENA Checklist		373.2	g
host length	ENA Checklist		33.3	cm
host scientific name	ENA Checklist		Salmo salar	
host storage container	ENA Checklist		LetSea Tank: Mars	
host storage container pH	ENA Checklist		7.05	
host storage container temperature	ENA Checklist		12.76	°C
host subject id	ENA Checklist		SB01.23	
host taxid	ENA Checklist		8030	
host total mass	ENA Checklist		441.6	g
library name	ENA Checklist		BEST	
library selection	ENA Checklist		PCR	
nucleic acid extraction	ENA Checklist		D-rex protocol	
organism	ENA Checklist		Salmo salar	
project	ENA Checklist		HoloFood	
project name	ENA Checklist		HoloFood Salmon - Host Genome	
reference host genome for decontamination	ENA Checklist		GCA_000000000.0	
sample storage buffer	ENA Checklist		Shield	
sample storage container	ENA Checklist		2ml E-matrix	
sample storage location	ENA Checklist		UCPH	
sample storage temperature	ENA Checklist		-20	°C
sample volume or weight for DNA extraction	ENA Checklist		0.2	mL
scientific_name	ENA Checklist		Salmo salar	
sequencing method	ENA Checklist		MGISEQ-2000	
title	ENA Checklist		SB01.23C1a	
trial timepoint	ENA Checklist		60	day
Body site	SAMPLE		distal gut content	
Experiment	SAMPLE		genomics	
Index PCR cycles	SAMPLE		10	
Lab Process ID	SAMPLE		LPS00626	
Omics	SAMPLE		Metagenomics	
Organism	SAMPLE		Salmon	
Pool	SAMPLE		S-MG-P31-531	
Project	SAMPLE		HoloFood	
Raw seq. name	SAMPLE		S-MG-P31-531/V300074385_L03_531	
Sample code	SAMPLE		SB01.23C1a	
Sequencing company	SAMPLE		BGI	
Treatment code	TREATMENT		Mars	
Treatment concentration	TREATMENT		0.0%	%
Treatment description	TREATMENT		Sanford Blue Mussel Meal	
Environment	TRIAL		Tanks (flow-through)	
Trial code	TRIAL		SB	
Trial description	TRIAL		Trial B: Blue mussel-dose response	
Trial end	TRIAL		2019-11-22	
Trial start	TRIAL		2019-08-14	
