marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA9068766 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:21:42Z INSDC last update ENA Checklist 2023-03-22T12:21:42Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS6797082 Submitter Id ENA Checklist SA07_27C1a_hostG adapters ENA Checklist AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT collection date ENA Checklist 2019-08-12 common name ENA Checklist Atlantic salmon description ENA Checklist Salmon host genomic data from Distal gut content; animal SA07.27 from tank SA07 with treatment Jaguar geographic location (country and/or sea) ENA Checklist Norway geographic location (latitude) ENA Checklist 66.079905 DD geographic location (longitude) ENA Checklist 12.587848 DD geographic location (region and locality) ENA Checklist Dønna; Nordland county host body site ENA Checklist Distal gut content host common name ENA Checklist Atlantic salmon host diet ENA Checklist Fermented algae meal (added in in oil coating) host diet treatment ENA Checklist Jaguar: SA 2.0% seaweed host diet treatment concentration ENA Checklist 2.0 % mass host disease status ENA Checklist Wounded:- host gutted mass ENA Checklist 570.2 g host length ENA Checklist 36.5 cm host scientific name ENA Checklist Salmo salar host storage container ENA Checklist LetSea Tank: Jaguar host storage container pH ENA Checklist 7.05 host storage container temperature ENA Checklist 12.76 °C host subject id ENA Checklist SA07.27 host taxid ENA Checklist 8030 host total mass ENA Checklist 667.6 g library name ENA Checklist BEST library selection ENA Checklist PCR nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist Salmo salar project ENA Checklist HoloFood project name ENA Checklist HoloFood Salmon - Host Genome reference host genome for decontamination ENA Checklist GCA_000000000.0 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist 2ml E-matrix sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist Salmo salar sequencing method ENA Checklist MGISEQ-2000 title ENA Checklist SA07.27C1a trial timepoint ENA Checklist 60 day Body site SAMPLE distal gut content Experiment SAMPLE genomics Index PCR cycles SAMPLE 9 Lab Process ID SAMPLE LPS00776 Omics SAMPLE Metagenomics Organism SAMPLE Salmon Pool SAMPLE S-MG-P9-525 Project SAMPLE HoloFood Raw seq. name SAMPLE S-MG-P9-525/V300074223_L01_525 Sample code SAMPLE SA07.27C1a Sequencing company SAMPLE BGI Treatment code TREATMENT Jaguar Treatment concentration TREATMENT 2.0% % Treatment description TREATMENT Fermented algae meal (added in in oil coating) Environment TRIAL Tanks (flow-through) Trial code TRIAL SA Trial description TRIAL Trial A: Seaweed-dose response Trial end TRIAL 2019-08-13 Trial start TRIAL 2019-06-11