marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA8141719 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:21:33Z INSDC last update ENA Checklist 2023-03-22T12:21:33Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS5828532 Submitter Id ENA Checklist SB01_01C1a_metaT adapters ENA Checklist AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT collection date ENA Checklist 2019-08-14 description ENA Checklist Salmon meta transcriptomic data from Distal gut content; animal SB01.01 from tank SB01 with treatment Mars geographic location (country and/or sea) ENA Checklist Norway geographic location (latitude) ENA Checklist 66.079905 DD geographic location (longitude) ENA Checklist 12.587848 DD geographic location (region and locality) ENA Checklist Dønna; Nordland county host body site ENA Checklist Distal gut content host common name ENA Checklist Atlantic salmon host diet ENA Checklist Sanford Blue Mussel Meal host diet treatment ENA Checklist Mars: SB Control host diet treatment concentration ENA Checklist 0 % mass host disease status ENA Checklist Wounded:- host gutted mass ENA Checklist 151.2 g host length ENA Checklist 25.5 cm host scientific name ENA Checklist Salmo salar host storage container ENA Checklist LetSea Tank: Mars host storage container pH ENA Checklist 7.05 host storage container temperature ENA Checklist 12.76 °C host subject id ENA Checklist SB01.01 host taxid ENA Checklist 8030 host total mass ENA Checklist 179.4 g library name ENA Checklist Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit library selection ENA Checklist rRNA depletion + strand specific library nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist fish gut metagenome project ENA Checklist HoloFood project name ENA Checklist HoloFood Salmon - MetaTranscriptomics reference host genome for decontamination ENA Checklist GCA_000000000.0 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist 2ml E-matrix sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist fish gut metagenome sequencing method ENA Checklist Illumina NovaSeq 6000 title ENA Checklist SB01.01C1a trial timepoint ENA Checklist 0 day Body site SAMPLE distal gut content Experiment SAMPLE metatranscriptomics Index PCR cycles SAMPLE 12 Lab Process ID SAMPLE LPS00518 Omics SAMPLE Metagenomics Organism SAMPLE Salmon Pool SAMPLE S-MG-P45-511 Project SAMPLE HoloFood Raw seq. name SAMPLE S-MG-P45-511/V300074300_L01_511 Sample code SAMPLE SB01.01C1a Sequencing company SAMPLE BGI Treatment code TREATMENT Mars Treatment concentration TREATMENT 0.0% % Treatment description TREATMENT Sanford Blue Mussel Meal Environment TRIAL Tanks (flow-through) Trial code TRIAL SB Trial description TRIAL Trial B: Blue mussel-dose response Trial end TRIAL 2019-11-22 Trial start TRIAL 2019-08-14