marker__name	marker__type	marker__canonical_url	measurement	units
ENA-CHECKLIST	ENA Checklist		ERC000052	
ENA-FIRST-PUBLIC	ENA Checklist		2022-08-02	
ENA-LAST-UPDATE	ENA Checklist		2022-08-02	
External Id	ENA Checklist		SAMEA7687891	
INSDC center alias	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC center name	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC first public	ENA Checklist		2022-08-02T16:46:25Z	
INSDC last update	ENA Checklist		2022-08-02T16:46:25Z	
INSDC status	ENA Checklist		public	
Organism	ENA Checklist		Salmo salar	
SRA accession	ENA Checklist		ERS5444421	
Submitter Id	ENA Checklist		SA01_18C1a_metaG	
adapters	ENA Checklist		AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;GAACGACATGGCTACGATCCGACTT	
collection date	ENA Checklist		2019-08-12	
description	ENA Checklist		Salmon metagenomic DNA data from Distal gut content; animal SA01.18 from tank SA01 with treatment Tiger	
geographic location (country and/or sea)	ENA Checklist		Norway	
geographic location (latitude)	ENA Checklist		66.079905	DD
geographic location (longitude)	ENA Checklist		12.587848	DD
geographic location (region and locality)	ENA Checklist		Dønna; Nordland county	
host body site	ENA Checklist		Distal gut content	
host common name	ENA Checklist		Atlantic salmon	
host diet	ENA Checklist		Fermented algae meal (added in in oil coating)	
host diet treatment	ENA Checklist		Tiger: SA Control	
host diet treatment concentration	ENA Checklist		0	% mass
host disease status	ENA Checklist		Wounded:-	
host gutted mass	ENA Checklist		496.6	g
host length	ENA Checklist		35.5	cm
host scientific name	ENA Checklist		Salmo salar	
host storage container	ENA Checklist		LetSea Tank: Tiger	
host storage container pH	ENA Checklist		7.05	
host storage container temperature	ENA Checklist		12.76	°C
host subject id	ENA Checklist		SA01.18	
host taxid	ENA Checklist		8030	
host total mass	ENA Checklist		592.2	g
nucleic acid extraction	ENA Checklist		D-rex protocol	
organism	ENA Checklist		fish gut metagenome	
project	ENA Checklist		HoloFood	
project name	ENA Checklist		HoloFood Salmon - Metagenomic DNA	
reference host genome for decontamination	ENA Checklist		GCA_000000000.0	
sample storage buffer	ENA Checklist		Shield	
sample storage container	ENA Checklist		2ml E-matrix	
sample storage location	ENA Checklist		UCPH	
sample storage temperature	ENA Checklist		-20	°C
sample volume or weight for DNA extraction	ENA Checklist		0.2	mL
sequencing method	ENA Checklist		MGISEQ-2000	
title	ENA Checklist		SA01.18C1a	
trial timepoint	ENA Checklist		60	day
Body site	SAMPLE		distal gut content	
Experiment	SAMPLE		metagenomics	
Index PCR cycles	SAMPLE		9	
Lab Process ID	SAMPLE		LPS00592	
Omics	SAMPLE		Metagenomics	
Organism	SAMPLE		Salmon	
Pool	SAMPLE		S-MG-P36-517	
Project	SAMPLE		HoloFood	
Raw seq. name	SAMPLE		S-MG-P36-517/V300074173_L04_517	
Sample code	SAMPLE		SA01.18C1a	
Sequencing company	SAMPLE		BGI	
Treatment code	TREATMENT		Tiger	
Treatment concentration	TREATMENT		0.0%	%
Treatment description	TREATMENT		Fermented algae meal (added in in oil coating)	
Environment	TRIAL		Tanks (flow-through)	
Trial code	TRIAL		SA	
Trial description	TRIAL		Trial A: Seaweed-dose response	
Trial end	TRIAL		2019-08-13	
Trial start	TRIAL		2019-06-11	
