marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA13929764 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:22:36Z INSDC last update ENA Checklist 2023-03-22T12:22:36Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS11530172 Submitter Id ENA Checklist CA10_10F1a_RAW_MetaT adapters ENA Checklist AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT collection date ENA Checklist 2019-02-26 common name ENA Checklist Chicken Meta Transcriptome description ENA Checklist Chicken meta transcriptome data from Caecum content; animal CA10.10 from cage CA10 with treatment CC; Raw data geographic location (country and/or sea) ENA Checklist Spain geographic location (latitude) ENA Checklist 41.170047 DD geographic location (longitude) ENA Checklist 1.168491 DD geographic location (region and locality) ENA Checklist El Morell; Tarragona host body site ENA Checklist Caecum content host breed ENA Checklist Ross host common name ENA Checklist Chicken host diet treatment ENA Checklist Control host disease status ENA Checklist Campylobacter:-;Salmonella:-;Clostridium:- host scientific name ENA Checklist Gallus gallus host sex ENA Checklist female host storage container temperature ENA Checklist 21 °C host subject id ENA Checklist CA10.10 host taxid ENA Checklist 9031 host total mass ENA Checklist 776.8 g library name ENA Checklist Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit library selection ENA Checklist cDNA_randomPriming nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist chicken gut metagenome project ENA Checklist HoloFood project name ENA Checklist HoloFood Chicken - Meta Transcriptome reference host genome for decontamination ENA Checklist GCF_000000000.0 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist E-matrix 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist chicken gut metagenome sequencing method ENA Checklist Illumina NovaSeq 6000 title ENA Checklist CA10.10F1a_MetaT trial length ENA Checklist 35 day trial timepoint ENA Checklist 21 day Body site SAMPLE caecum content Experiment SAMPLE metatranscriptomics Index PCR cycles SAMPLE 10 Lab Process ID SAMPLE LPC00014 Organism SAMPLE Chicken Pool SAMPLE PRICH-10BM-514 Project SAMPLE HoloFood Raw sequence name SAMPLE F20FTSEUET0072_GALpdyR/PRICH-10BM-514/V300066503_L03_514 Sample code SAMPLE CA10.10F1a Sequencing company SAMPLE BGI ng used for library build SAMPLE 390.6 Treatment code TREATMENT CC Treatment name TREATMENT Control Trial code TRIAL CA Trial description TRIAL Trial 1 Trial end TRIAL 2019-03-11 Trial start TRIAL 2019-02-04