marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA13389300 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:22:28Z INSDC last update ENA Checklist 2023-03-22T12:22:28Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS10991797 Submitter Id ENA Checklist CB01_09C1a_PCIC_HostG adapters ENA Checklist AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date ENA Checklist 2019-05-20 common name ENA Checklist chicken description ENA Checklist Chicken host genomic data from Ileum content; animal CB01.09 from cage CB01 with treatment CE geographic location (country and/or sea) ENA Checklist Spain geographic location (latitude) ENA Checklist 41.170047 DD geographic location (longitude) ENA Checklist 1.168491 DD geographic location (region and locality) ENA Checklist El Morell; Tarragona host body site ENA Checklist Ileum content host breed ENA Checklist Cobb host common name ENA Checklist Chicken host diet treatment ENA Checklist Prebiotic host disease status ENA Checklist Campylobacter:-;Salmonella:-;Clostridium:- host scientific name ENA Checklist Gallus gallus host sex ENA Checklist female host storage container temperature ENA Checklist 21 °C host subject id ENA Checklist CB01.09 host taxid ENA Checklist 9031 host total mass ENA Checklist 950.0 g library name ENA Checklist BEMT library selection ENA Checklist PCR nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist Gallus gallus project ENA Checklist HoloFood project name ENA Checklist HoloFood Chicken - Host Genome reference host genome for decontamination ENA Checklist GCF_000002315.6 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist E-matrix 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist Gallus gallus sequencing method ENA Checklist MGISEQ-2000 title ENA Checklist CB01.09C1a_HostG trial length ENA Checklist 35 day trial timepoint ENA Checklist 21 day Body site SAMPLE ileum content Experiment SAMPLE genomics Organism SAMPLE Chicken Project SAMPLE HoloFood Sample code SAMPLE CB01.09C1a Treatment code TREATMENT CE Treatment name TREATMENT Prebiotic Trial code TRIAL CB Trial description TRIAL Trial 2 Trial end TRIAL 2019-05-19 Trial start TRIAL 2019-04-21