marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA13389245 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:22:25Z INSDC last update ENA Checklist 2023-03-22T12:22:25Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS10991742 Submitter Id ENA Checklist CA20_10F1a_MAGCC_HostG adapters ENA Checklist AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date ENA Checklist 2019-02-26 common name ENA Checklist chicken description ENA Checklist Chicken host genomic data from Caecum content; animal CA20.10 from cage CA20 with treatment CO geographic location (country and/or sea) ENA Checklist Spain geographic location (latitude) ENA Checklist 41.170047 DD geographic location (longitude) ENA Checklist 1.168491 DD geographic location (region and locality) ENA Checklist El Morell; Tarragona host body site ENA Checklist Caecum content host breed ENA Checklist Cobb host common name ENA Checklist Chicken host diet treatment ENA Checklist Probiotic host disease status ENA Checklist Campylobacter:-;Salmonella:-;Clostridium:- host scientific name ENA Checklist Gallus gallus host sex ENA Checklist female host storage container temperature ENA Checklist 21 °C host subject id ENA Checklist CA20.10 host taxid ENA Checklist 9031 host total mass ENA Checklist 1057.0 g library name ENA Checklist BEMT library selection ENA Checklist PCR nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist Gallus gallus project ENA Checklist HoloFood project name ENA Checklist HoloFood Chicken - Host Genome reference host genome for decontamination ENA Checklist GCF_000002315.6 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist E-matrix 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist Gallus gallus sequencing method ENA Checklist MGISEQ-2000 title ENA Checklist CA20.10F1a_HostG trial length ENA Checklist 35 day trial timepoint ENA Checklist 21 day Body site SAMPLE caecum content Experiment SAMPLE genomics Index PCR cycles SAMPLE 12 Lab Process ID SAMPLE LPC00310 Organism SAMPLE Chicken Pool SAMPLE MAG04-510 Project SAMPLE HoloFood Raw sequence name SAMPLE F19FTSEUET0172_MICshtR/MAG04/200219_I076_V300042185_L4_CDK153B200218004-510/V300042185_L04_510 Sample code SAMPLE CA20.10F1a Sequencing company SAMPLE BGI ng used for library build SAMPLE 400.4 Treatment code TREATMENT CO Treatment name TREATMENT Probiotic Trial code TRIAL CA Trial description TRIAL Trial 1 Trial end TRIAL 2019-03-11 Trial start TRIAL 2019-02-04