marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-04-21 ENA-LAST-UPDATE ENA Checklist 2023-04-21 External Id ENA Checklist SAMEA112750572 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-04-21T12:19:59Z INSDC last update ENA Checklist 2023-04-21T12:19:59Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS14745265 Submitter Id ENA Checklist SD11_16C1a_16S adapters ENA Checklist AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT collection date ENA Checklist 2022-04-04 common name ENA Checklist Atlantic salmon description ENA Checklist Salmon 16S amplicon sequencing data from Distal gut content; animal SD11.16 from tank SD11 with treatment SK2 geographic location (country and/or sea) ENA Checklist Norway geographic location (latitude) ENA Checklist 66.079905 DD geographic location (longitude) ENA Checklist 12.587848 DD geographic location (region and locality) ENA Checklist Dønna; Nordland county host body site ENA Checklist Distal gut content host common name ENA Checklist Atlantic salmon host diet ENA Checklist Seaweed host diet treatment ENA Checklist SK2 SD Fermented seaweed 2.0% host diet treatment concentration ENA Checklist 2.0 % mass host disease status ENA Checklist Wounded:- host gutted mass ENA Checklist 1795 g host length ENA Checklist 55.50 cm host scientific name ENA Checklist Salmo salar host storage container ENA Checklist LetSea Tank: SK2 host storage container pH ENA Checklist 7.05 host storage container temperature ENA Checklist 12.76 °C host subject id ENA Checklist SD11.16 host taxid ENA Checklist 8030 host total mass ENA Checklist 2065 g library name ENA Checklist BEST library selection ENA Checklist PCR nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist Salmo salar pcr primers ENA Checklist N/A project ENA Checklist HoloFood project name ENA Checklist Holofood Salmon 16S amplicon sequencing reference host genome for decontamination ENA Checklist GCA_000000000.0 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist 2ml E-matrix sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist Salmo salar sequencing method ENA Checklist Illumina MiSeq title ENA Checklist SD11.16C1a trial timepoint ENA Checklist 209 days Body site SAMPLE distal gut content Experiment SAMPLE amplicon Organism SAMPLE Salmon Project SAMPLE HoloFood Sample code SAMPLE SD11.16C1a Treatment code TREATMENT SK2 Treatment concentration TREATMENT 2.0% % Treatment description TREATMENT Seaweed Environment TRIAL Open sea pens Trial code TRIAL SD Trial description TRIAL Trial D: Fermented seaweed open water-dose response Trial end TRIAL 2022-05-05 Trial start TRIAL 2021-10-05