marker__name	marker__type	marker__canonical_url	measurement	units
ENA-CHECKLIST	ENA Checklist		ERC000052	
ENA-FIRST-PUBLIC	ENA Checklist		2023-03-22	
ENA-LAST-UPDATE	ENA Checklist		2023-03-22	
External Id	ENA Checklist		SAMEA112369747	
INSDC center alias	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC center name	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC first public	ENA Checklist		2023-03-22T12:24:19Z	
INSDC last update	ENA Checklist		2023-03-22T12:24:19Z	
INSDC status	ENA Checklist		public	
SRA accession	ENA Checklist		ERS14480065	
Submitter Id	ENA Checklist		SB02_21B1a_hostT	
adapters	ENA Checklist		AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT	
collection date	ENA Checklist		2019-10-14	
common name	ENA Checklist		Atlantic salmon	
description	ENA Checklist		Salmon host transcriptome data from Distal gut tissue; animal SB02.21 from tank SB02 with treatment Neptune	
geographic location (country and/or sea)	ENA Checklist		Norway	
geographic location (latitude)	ENA Checklist		66.079905	DD
geographic location (longitude)	ENA Checklist		12.587848	DD
geographic location (region and locality)	ENA Checklist		Dønna; Nordland county	
host body site	ENA Checklist		Distal gut tissue	
host common name	ENA Checklist		Atlantic salmon	
host diet	ENA Checklist		Sanford Blue Mussel Meal	
host diet treatment	ENA Checklist		Neptune SB Blue mussel 13.1%	
host diet treatment concentration	ENA Checklist		13.1	% mass
host disease status	ENA Checklist		Wounded:-	
host gutted mass	ENA Checklist		367.70	g
host length	ENA Checklist		32.50	cm
host scientific name	ENA Checklist		Salmo salar	
host storage container	ENA Checklist		LetSea Tank: Neptune	
host storage container pH	ENA Checklist		7.05	
host storage container temperature	ENA Checklist		12.76	°C
host subject id	ENA Checklist		SB02.21	
host taxid	ENA Checklist		8030	
host total mass	ENA Checklist		424.40	g
library name	ENA Checklist		Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit	
library selection	ENA Checklist		rRNA depletion + strand specific library	
nucleic acid extraction	ENA Checklist		D-rex protocol	
organism	ENA Checklist		Salmo salar	
project	ENA Checklist		HoloFood	
project name	ENA Checklist		HoloFood Salmon - Host Transcriptome	
reference host genome for decontamination	ENA Checklist		GCA_000000000.0	
sample storage buffer	ENA Checklist		RNAlater	
sample storage container	ENA Checklist		2ml	
sample storage location	ENA Checklist		UCPH	
sample storage temperature	ENA Checklist		-20	°C
sample volume or weight for DNA extraction	ENA Checklist		0.2	mL
scientific_name	ENA Checklist		Salmo salar	
sequencing method	ENA Checklist		Illumina Novaseq 6000	
title	ENA Checklist		SB02.21B1a	
trial timepoint	ENA Checklist		60	day
Body site	SAMPLE		distal gut tissue	
Experiment	SAMPLE		transcriptomics	
Organism	SAMPLE		Salmon	
Project	SAMPLE		HoloFood	
Sample code	SAMPLE		SB02.21B1a	
Treatment code	TREATMENT		Neptune	
Treatment concentration	TREATMENT		13.1%	%
Treatment description	TREATMENT		Sanford Blue Mussel Meal	
Environment	TRIAL		Tanks (flow-through)	
Trial code	TRIAL		SB	
Trial description	TRIAL		Trial B: Blue mussel-dose response	
Trial end	TRIAL		2019-11-22	
Trial start	TRIAL		2019-08-14	
