marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA112369735 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:24:22Z INSDC last update ENA Checklist 2023-03-22T12:24:22Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS14480053 Submitter Id ENA Checklist SB02_04B1a_hostT adapters ENA Checklist AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT collection date ENA Checklist 2019-08-14 common name ENA Checklist Atlantic salmon description ENA Checklist Salmon host transcriptome data from Distal gut tissue; animal SB02.04 from tank SB02 with treatment Neptune geographic location (country and/or sea) ENA Checklist Norway geographic location (latitude) ENA Checklist 66.079905 DD geographic location (longitude) ENA Checklist 12.587848 DD geographic location (region and locality) ENA Checklist Dønna; Nordland county host body site ENA Checklist Distal gut tissue host common name ENA Checklist Atlantic salmon host diet ENA Checklist Sanford Blue Mussel Meal host diet treatment ENA Checklist Neptune SB Blue mussel 13.1% host diet treatment concentration ENA Checklist 0 % mass host disease status ENA Checklist Wounded:- host gutted mass ENA Checklist 145.00 g host length ENA Checklist 25.50 cm host scientific name ENA Checklist Salmo salar host storage container ENA Checklist LetSea Tank: Neptune host storage container pH ENA Checklist 7.05 host storage container temperature ENA Checklist 12.76 °C host subject id ENA Checklist SB02.04 host taxid ENA Checklist 8030 host total mass ENA Checklist 173.00 g library name ENA Checklist Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit library selection ENA Checklist rRNA depletion + strand specific library nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist Salmo salar project ENA Checklist HoloFood project name ENA Checklist HoloFood Salmon - Host Transcriptome reference host genome for decontamination ENA Checklist GCA_000000000.0 sample storage buffer ENA Checklist RNAlater sample storage container ENA Checklist 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist Salmo salar sequencing method ENA Checklist Illumina Novaseq 6000 title ENA Checklist SB02.04B1a trial timepoint ENA Checklist 0 day Body site SAMPLE distal gut tissue Experiment SAMPLE transcriptomics Organism SAMPLE Salmon Project SAMPLE HoloFood Sample code SAMPLE SB02.04B1a Treatment code TREATMENT Neptune Treatment concentration TREATMENT 13.1% % Treatment description TREATMENT Sanford Blue Mussel Meal Environment TRIAL Tanks (flow-through) Trial code TRIAL SB Trial description TRIAL Trial B: Blue mussel-dose response Trial end TRIAL 2019-11-22 Trial start TRIAL 2019-08-14