marker__name	marker__type	marker__canonical_url	measurement	units
ENA-CHECKLIST	ENA Checklist		ERC000052	
ENA-FIRST-PUBLIC	ENA Checklist		2023-03-22	
ENA-LAST-UPDATE	ENA Checklist		2023-03-22	
External Id	ENA Checklist		SAMEA112369596	
INSDC center alias	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC center name	ENA Checklist		UNIVERSITY OF COPENHAGEN	
INSDC first public	ENA Checklist		2023-03-22T12:24:20Z	
INSDC last update	ENA Checklist		2023-03-22T12:24:20Z	
INSDC status	ENA Checklist		public	
SRA accession	ENA Checklist		ERS14479914	
Submitter Id	ENA Checklist		SA06_01B1a_hostT	
adapters	ENA Checklist		AGATCGGAAGAGCACACGTCTGAACTCCAGTCA;AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT	
collection date	ENA Checklist		2019-06-11	
common name	ENA Checklist		Atlantic salmon	
description	ENA Checklist		Salmon host transcriptome data from Distal gut tissue; animal SA06.01 from tank SA06 with treatment Tiger	
geographic location (country and/or sea)	ENA Checklist		Norway	
geographic location (latitude)	ENA Checklist		66.079905	DD
geographic location (longitude)	ENA Checklist		12.587848	DD
geographic location (region and locality)	ENA Checklist		Dønna; Nordland county	
host body site	ENA Checklist		Distal gut tissue	
host common name	ENA Checklist		Atlantic salmon	
host diet	ENA Checklist		Fermented algae meal (added in in oil coating)	
host diet treatment	ENA Checklist		Tiger SA Seaweed 0%	
host diet treatment concentration	ENA Checklist		0	% mass
host disease status	ENA Checklist		Wounded:+	
host gutted mass	ENA Checklist		235.00	g
host length	ENA Checklist		27.00	cm
host scientific name	ENA Checklist		Salmo salar	
host storage container	ENA Checklist		LetSea Tank: Tiger	
host storage container pH	ENA Checklist		7.05	
host storage container temperature	ENA Checklist		12.76	°C
host subject id	ENA Checklist		SA06.01	
host taxid	ENA Checklist		8030	
host total mass	ENA Checklist		276.80	g
library name	ENA Checklist		Illumina Ribo-Zero Plus rRNA Depletion Kit + NEB Next Ultra RNA Library Prep Kit	
library selection	ENA Checklist		rRNA depletion + strand specific library	
nucleic acid extraction	ENA Checklist		D-rex protocol	
organism	ENA Checklist		Salmo salar	
project	ENA Checklist		HoloFood	
project name	ENA Checklist		HoloFood Salmon - Host Transcriptome	
reference host genome for decontamination	ENA Checklist		GCA_000000000.0	
sample storage buffer	ENA Checklist		RNAlater	
sample storage container	ENA Checklist		2ml	
sample storage location	ENA Checklist		UCPH	
sample storage temperature	ENA Checklist		-20	°C
sample volume or weight for DNA extraction	ENA Checklist		0.2	mL
scientific_name	ENA Checklist		Salmo salar	
sequencing method	ENA Checklist		Illumina Novaseq 6000	
title	ENA Checklist		SA06.01B1a	
trial timepoint	ENA Checklist		0	day
Body site	SAMPLE		distal gut tissue	
Experiment	SAMPLE		transcriptomics	
Organism	SAMPLE		Salmon	
Project	SAMPLE		HoloFood	
Sample code	SAMPLE		SA06.01B1a	
Treatment code	TREATMENT		Tiger	
Treatment concentration	TREATMENT		0.0%	%
Treatment description	TREATMENT		Fermented algae meal (added in in oil coating)	
Environment	TRIAL		Tanks (flow-through)	
Trial code	TRIAL		SA	
Trial description	TRIAL		Trial A: Seaweed-dose response	
Trial end	TRIAL		2019-08-13	
Trial start	TRIAL		2019-06-11	
