marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA10455493 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:22:02Z INSDC last update ENA Checklist 2023-03-22T12:22:02Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS8107684 Submitter Id ENA Checklist CB09_18F1a_FUB_metaG adapters ENA Checklist AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date ENA Checklist 2019-06-05 common name ENA Checklist Chicken Gut Metagenome description ENA Checklist Chicken gut metagenomic data from Caecum content; animal CB09.18 from cage CB09 with treatment CO geographic location (country and/or sea) ENA Checklist Spain geographic location (latitude) ENA Checklist 41.170047 DD geographic location (longitude) ENA Checklist 1.168491 DD geographic location (region and locality) ENA Checklist El Morell; Tarragona host body site ENA Checklist Caecum content host breed ENA Checklist Ross host common name ENA Checklist Chicken host diet treatment ENA Checklist Probiotic host disease status ENA Checklist Campylobacter:-;Salmonella:-;Clostridium:- host scientific name ENA Checklist Gallus gallus host sex ENA Checklist male host storage container temperature ENA Checklist 21 °C host subject id ENA Checklist CB09.18 host taxid ENA Checklist 9031 host total mass ENA Checklist 1974.4 g library name ENA Checklist BEMT library selection ENA Checklist PCR nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist chicken gut metagenome project ENA Checklist HoloFood project name ENA Checklist HoloFood Chicken - Prior Chicken reference host genome for decontamination ENA Checklist GCF_000002315.6 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist E-matrix 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist chicken gut metagenome sequencing method ENA Checklist MGISEQ-2000 title ENA Checklist CB09.18F1a.FUB trial length ENA Checklist 35 day trial timepoint ENA Checklist 35 day Body site SAMPLE caecum content Experiment SAMPLE metagenomics Organism SAMPLE Chicken Project SAMPLE HoloFood Sample code SAMPLE CB09.18F1a Treatment code TREATMENT CO Treatment name TREATMENT Probiotic Trial code TRIAL CB Trial description TRIAL Trial 2 Trial end TRIAL 2019-05-19 Trial start TRIAL 2019-04-21