marker__name marker__type marker__canonical_url measurement units ENA-CHECKLIST ENA Checklist ERC000052 ENA-FIRST-PUBLIC ENA Checklist 2023-03-22 ENA-LAST-UPDATE ENA Checklist 2023-03-22 External Id ENA Checklist SAMEA10130125 INSDC center alias ENA Checklist UNIVERSITY OF COPENHAGEN INSDC center name ENA Checklist UNIVERSITY OF COPENHAGEN INSDC first public ENA Checklist 2023-03-22T12:21:56Z INSDC last update ENA Checklist 2023-03-22T12:21:56Z INSDC status ENA Checklist public SRA accession ENA Checklist ERS7786652 Submitter Id ENA Checklist CC23_17C1a_metaG adapters ENA Checklist AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA;AAGTCGGATCGTAGCCATGTCGTTC collection date ENA Checklist 2019-10-16 common name ENA Checklist Chicken Gut Metagenome description ENA Checklist Chicken gut metagenomic data from Ileum content; animal CC23.17 from cage CC23 with treatment CE geographic location (country and/or sea) ENA Checklist Spain geographic location (latitude) ENA Checklist 41.170047 DD geographic location (longitude) ENA Checklist 1.168491 DD geographic location (region and locality) ENA Checklist El Morell; Tarragona host body site ENA Checklist Ileum content host breed ENA Checklist Cobb host common name ENA Checklist Chicken host diet treatment ENA Checklist Prebiotic host disease status ENA Checklist Campylobacter:+;Salmonella:-;Clostridium:- host scientific name ENA Checklist Gallus gallus host sex ENA Checklist male host storage container temperature ENA Checklist 21 °C host subject id ENA Checklist CC23.17 host taxid ENA Checklist 9031 host total mass ENA Checklist 1992.0 g library name ENA Checklist BEMT library selection ENA Checklist PCR nucleic acid extraction ENA Checklist D-rex protocol organism ENA Checklist chicken gut metagenome project ENA Checklist HoloFood project name ENA Checklist HoloFood Chicken - Prior Chicken Ileum Content reference host genome for decontamination ENA Checklist GCF_000002315.6 sample storage buffer ENA Checklist Shield sample storage container ENA Checklist E-matrix 2ml sample storage location ENA Checklist UCPH sample storage temperature ENA Checklist -20 °C sample volume or weight for DNA extraction ENA Checklist 0.2 mL scientific_name ENA Checklist chicken gut metagenome sequencing method ENA Checklist MGISEQ-2000 title ENA Checklist CC23.17C1a trial length ENA Checklist 35 day trial timepoint ENA Checklist 35 day Body site SAMPLE ileum content Experiment SAMPLE metagenomics Organism SAMPLE Chicken Project SAMPLE HoloFood Sample code SAMPLE CC23.17C1a Treatment code TREATMENT CE Treatment name TREATMENT Prebiotic Trial code TRIAL CC Trial description TRIAL Trial 3 Trial end TRIAL 2019-07-14 Trial start TRIAL 2019-06-09